| Allele Name | tm731 |
| Balance | Not Required |
| OutCross | Not Accepted |
| Sequence Name | F56F11.3 |
| Gene Name | klf-1 |
| Worm Base | Allele Name |
tm731
|
| Gene Name |
klf-1
|
| Sequence |
F56F11.3
|
Phenotype
Information from the receiver is posted in the form
of a "researcher : phenotype"
| homozygous viable |
Mutation site
Please see gene structure to locate the deletion in
relation to exon(s)
| 26137/26138-26480/26481 (343 bp deletion) |
| Chromosome | III |
| Putative gene structure | join(24132..24267, 24829..25001, 25915..26107, 26901..26981, 27567..27863, 28534..28971, 29334..29423, 29578..29663) |
| Map position | -9.93 |
| Balancer | |
| Map position of balancer | |
| Sequence of primers | IntFwd:AATGACCGTCTGGAACAGAT,ExtFwd:ACTCAACTCAGAGCCTTTTC,ExtRev:TCGGACTATCCATGTCAGCA,IntRev:GCATCCTCCACAACAATACT |
| Distributed lab | |
| Depositor | Dr. S. Mitani |
| References |
Please submit your publication
Hsieh PN, Zhou G, Yuan Y, Zhang R, Prosdocimo DA, Sangwung P, Borton AH, Boriushkin E, Hamik A, Fujioka H, Fealy CE, Kirwan JP, Peters M, Lu Y, Liao X, Ramírez-Bergeron D, Feng Z, Jain MK. A conserved KLF-autophagy pathway modulates nematode lifespan and mammalian age-associated vascular dysfunction. Nat Commun 2017 8(1) 914
[ PubMed ID = 29030550 ]
[ RRC reference ]
|
Carrano AC, Dillin A, Hunter T. A Krüppel-like factor downstream of the E3 ligase WWP-1 mediates dietary-restriction-induced longevity in Caenorhabditis elegans. Nat Commun 2014 5 3772
[ PubMed ID = 24805825 ]
[ RRC reference ]
|
|