分離済み変異体

tm729

Allele Name

tm729

Balance

Not Required

OutCross

Not Accepted

Sequence Name

K04B12.1

Gene Name

plx-2

Worm Base

Allele Name

tm729

Gene Name

plx-2

Sequence

K04B12.1

Phenotype

homozygous viable. Dr. K. Shen: normal DA presynaptic puncta. Dr. S. Takagi: apparently normal, enhancer of weak alleles of mab-20 (bx61 & bx24).

Mutation site

7631/7632-9291/9292 (1660 bp deletion)

Chromosome

Putative gene structure

complement(join(2683..2886, 2932..3111, 3161..3627, 3677..3847, 3896..4052, 4674..5768, 5826..6590, 6640..6794, 6857..7514, 7559..7693, 7747..7881, 8090..8254, 8305..8557, 8606..9255, 9390..9549, 10205..10275))

Map position

Balancer

Map position of balancer

Sequence of primers

ExtFwd:CTCGTAGTGTTGCTCAAAGT,IntFwd:CTTGCCACAACGGATACTAT,IntRev:AGCCGCCCTTTGAAACAGAA,ExtRev:GCCATTTTCTGCGGGCGGTA

Distributed lab

Depositor

Dr. S. Mitani/NBRP

References

Please submit your publication

Harreguy MB, Tanvir Z, Shah E, Simprevil B, Tran TS, Haspel G.
Semaphorin signaling restricts neuronal regeneration in C. elegans.
Front Cell Dev Biol 2022 10 814160
[ PubMed ID = 36325362 ] [ RRC reference ]

Nakamura F, Okada T, Shishikura M, Uetani N, Taniguchi M, Yagi T, Iwakura Y, Ohshima T, Goshima Y, Strittmatter SM.
Protein Tyrosine Phosphatase δ Mediates the Sema3A-Induced Cortical Basal Dendritic Arborization through the Activation of Fyn Tyrosine Kinase.
J Neurosci 2017 37(30) 7125-7139
[ PubMed ID = 28637841 ] [ RRC reference ]

Schwieterman AA, Steves AN, Yee V, Donelson CJ, Bentley MR, Santorella EM, Mehlenbacher TV, Pital A, Howard AM, Wilson MR, Ereddia DE, Effrein KS, McMurry JL, Ackley BD, Chisholm AD, Hudson ML.
The Caenorhabditis elegans Ephrin EFN-4 Functions Non-cell Autonomously with Heparan Sulfate Proteoglycans to Promote Axon Outgrowth and Branching.
Genetics 2016 202(2) 639-60
[ PubMed ID = 26645816 ] [ RRC reference ]

Nakamura F, Kumeta K, Hida T, Isono T, Nakayama Y, Kuramata-Matsuoka E, Yamashita N, Uchida Y, Ogura K, Gengyo-Ando K, Mitani S, Ogino T, Goshima Y.
Amino- and carboxyl-terminal domains of Filamin-A interact with CRMP1 to mediate Sema3A signalling.
Nat Commun 2014 5 5325
[ PubMed ID = 25358863 ] [ RRC reference ]

Mizumoto K, Shen K.
Interaxonal interaction defines tiled presynaptic innervation in C. elegans.
Neuron 2013 77(4) 655-66
[ PubMed ID = 23439119 ] [ RRC reference ]

Nakao F, Hudson ML, Suzuki M, Peckler Z, Kurokawa R, Liu Z, Gengyo-Ando K, Nukazuka A, Fujii T, Suto F, Shibata Y, Shioi G, Fujisawa H, Mitani S, Chisholm AD, Takagi S.
The PLEXIN PLX-2 and the ephrin EFN-4 have distinct roles in MAB-20/Semaphorin 2A signaling in Caenorhabditis elegans morphogenesis.
Genetics 2007 176(3) 1591-607
[ PubMed ID = 17507686 ] [ RRC reference ]

Ikegami R, Zheng H, Ong SH, Culotti J.
Integration of semaphorin-2A/MAB-20, ephrin-4, and UNC-129 TGF-beta signaling pathways regulates sorting of distinct sensory rays in C. elegans.
Dev Cell 2004 6(3) 383-95
[ PubMed ID = 15030761 ] [ RRC reference ]