分離済み変異体

tm718

Allele Nametm718
BalanceNot Required
OutCrossNot Accepted
Sequence NameB0034.3a
Gene Namecasy-1
Worm BaseAllele Name tm718
Gene Name casy-1
Sequence B0034.3a
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable. Dr. O. Hobert: no neurotransmission phenotype (aldicarb/levamisole sensitivity). Dr. K. Shen: Normal HSN vulval presynaptic vesicle clusters (unc-86::SNB-1::YFP). Dr. C. Rongo: normal GLR-1::GFP localization and expression. Dr. Y. Iino: Proc Natl Acad Sci U S A 105, 5260 (2008)
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 10863/10864-11464/11465 (601 bp deletion)
ChromosomeII
Putative gene structurecomplement(join(1989..2148,2614..2747,3023..3141, 3368..3449, 7555..7731, 9215..9283, 9382..9543, 9600..9748, 9799..10593, 10639..11530, 11755..11858, 12545..12649, 2703..12778))
Map position-0.79
Balancer
Map position of balancer
Sequence of primersIntFwd:CGTCTTTGTCATGCTCAAAC,ExtFwd:TGAATCTGTCTGGGACTTAC,IntRev:TACACTGGAGCAGCTGTACT,ExtRev:CCATTCGACATCCAGGTTGT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Majeed M, Liao CP, Hobert O.
Nervous system-wide analysis of all C. elegans cadherins reveals neuron-specific functions across multiple anatomical scales.
Sci Adv 2025 11(8) eads2852 
[ PubMed ID = 39983000 ] [ RRC reference ]

Ohno H, Komachiya Y, Iino Y.
The cadherin domains and the kinesin-binding intracellular domain of CASY-1/calsyntenin function in a redundant manner for learning.
MicroPubl Biol 2025 2025  
[ PubMed ID = 40452869 ] [ RRC reference ]

Tang LTH, Lee GA, Cook SJ, Ho J, Potter CC, Bülow HE.
Anatomical restructuring of a lateralized neural circuit during associative learning by asymmetric insulin signaling.
Curr Biol 2023 33(18) 3835-3850.e6 
[ PubMed ID = 37591249 ] [ RRC reference ]

Ding C, Wu Y, Dabas H, Hammarlund M.
Activation of the CaMKII-Sarm1-ASK1-p38 MAP kinase pathway protects against axon degeneration caused by loss of mitochondria.
Elife 2022 11  
[ PubMed ID = 35285800 ] [ RRC reference ]

Nagashima T, Iino Y, Tomioka M.
DAF-16/FOXO promotes taste avoidance learning independently of axonal insulin-like signaling.
PLoS Genet 2019 15(7) e1008297 
[ PubMed ID = 31323047 ] [ RRC reference ]

Thapliyal S, Babu K.
Pentylenetetrazole (PTZ)-induced Convulsion Assay to Determine GABAergic Defects in Caenorhabditis elegans.
Bio Protoc 2018 8(17)  
[ PubMed ID = 30283811 ] [ RRC reference ]

Thapliyal S, Ravindranath S, Babu K.
Regulation of Glutamate Signaling in the Sensorimotor Circuit by CASY-1A/Calsyntenin in Caenorhabditis elegans.
Genetics 2018 208(4) 1553-1564 
[ PubMed ID = 29475851 ] [ RRC reference ]

Thapliyal S, Vasudevan A, Dong Y, Bai J, Koushika SP, Babu K.
The C-terminal of CASY-1/Calsyntenin regulates GABAergic synaptic transmission at the Caenorhabditis elegans neuromuscular junction.
PLoS Genet 2018 14(3) e1007263 
[ PubMed ID = 29529030 ] [ RRC reference ]

Hong M, Ryu L, Ow MC, Kim J, Je AR, Chinta S, Huh YH, Lee KJ, Butcher RA, Choi H, Sengupta P, Hall SE, Kim K.
Early Pheromone Experience Modifies a Synaptic Activity to Influence Adult Pheromone Responses of C. elegans.
Curr Biol 2017 27(20) 3168-3177.e3 
[ PubMed ID = 28988862 ] [ RRC reference ]

Kim B, Emmons SW.
Multiple conserved cell adhesion protein interactions mediate neural wiring of a sensory circuit in C. elegans.
Elife 2017 6  
[ PubMed ID = 28901288 ] [ RRC reference ]

Ohno H, Sakai N, Adachi T, Iino Y.
Dynamics of Presynaptic Diacylglycerol in a Sensory Neuron Encode Differences between Past and Current Stimulus Intensity.
Cell Rep 2017 20(10) 2294-2303 
[ PubMed ID = 28877465 ] [ RRC reference ]

Ohno H, Kato S, Naito Y, Kunitomo H, Tomioka M, Iino Y.
Role of synaptic phosphatidylinositol 3-kinase in a behavioral learning response in C. elegans.
Science 2014 345(6194) 313-7 
[ PubMed ID = 25035490 ] [ RRC reference ]

Steimel A, Wong L, Najarro EH, Ackley BD, Garriga G, Hutter H.
The Flamingo ortholog FMI-1 controls pioneer-dependent navigation of follower axons in C. elegans.
Development 2010 137(21) 3663-73 
[ PubMed ID = 20876647 ] [ RRC reference ]

Hoerndli FJ, Walser M, Fröhli Hoier E, de Quervain D, Papassotiropoulos A, Hajnal A.
A conserved function of C. elegans CASY-1 calsyntenin in associative learning.
PLoS One 2009 4(3) e4880 
[ PubMed ID = 19287492 ] [ RRC reference ]

Ikeda DD, Duan Y, Matsuki M, Kunitomo H, Hutter H, Hedgecock EM, Iino Y.
CASY-1, an ortholog of calsyntenins/alcadeins, is essential for learning in Caenorhabditis elegans.
Proc Natl Acad Sci U S A 2008 105(13) 5260-5 
[ PubMed ID = 18381821 ] [ RRC reference ]