Allele Name | tm698 |
Allele Type | 通常株 |
Sequence Name | T22H2.5a |
Gene Name | scrm-1 |
Worm Base | Allele Name |
tm698
|
Gene Name |
scrm-1
|
Sequence |
T22H2.5a
|
Phenotype
Information from the receiver is posted in the form of a "researcher : phenotype"
| homozygous viable |
Mutation site
Please see gene structure to locate the deletion in relation to exon(s)
| 165/166-1027/1028 (862 bp deletion) |
Chromosome | I |
Putative gene structure | complement(join(772..776, 1008..1053, 1101..1159, 1206..1308, 1715..2017, 2118..2192)) |
Map position | 9.53 |
Balancer | |
Map position of balancer | |
Sequence of primers | ExtRev:TCACGTCACGTGAATCACTA,IntRev:CCAGATTGTAGCGCTGAATT,ExtFwd:GGTCTTGCAGTTCAACGTAA,IntFwd:AACCGGTGGAGCAGGGTTAA |
Distributed lab | |
Depositor | Dr. S. Mitani |
References |
Please submit your publication
Mitani S. Comprehensive functional genomics using Caenorhabditis elegans as a model organism. Proc Jpn Acad Ser B Phys Biol Sci 2017 93(8) 561-577
[ PubMed ID = 29021508 ]
[ RRC reference ]
|
Hsu TY, Wu YC. Engulfment of apoptotic cells in C. elegans is mediated by integrin alpha/SRC signaling. Curr Biol 2010 20(6) 477-86
[ PubMed ID = 20226672 ]
[ RRC reference ]
|
Yu H, Aleman-Meza B, Gharib S, Labocha MK, Cronin CJ, Sternberg PW, Zhong W. Systematic profiling of Caenorhabditis elegans locomotive behaviors reveals additional components in G-protein Gαq signaling. Proc Natl Acad Sci U S A 2013 110(29) 11940-5
[ PubMed ID = 23818641 ]
[ RRC reference ]
|
Wang X, Wang J, Gengyo-Ando K, Gu L, Sun CL, Yang C, Shi Y, Kobayashi T, Shi Y, Mitani S, Xie XS, Xue D. C. elegans mitochondrial factor WAH-1 promotes phosphatidylserine externalization in apoptotic cells through phospholipid scramblase SCRM-1. Nat Cell Biol 2007 9(5) 541-9
[ PubMed ID = 17401362 ]
[ RRC reference ]
|
|