分離済み変異体

tm690

Allele Name

tm690

Balance

Not Required

OutCross

Not Accepted

Sequence Name

C06G4.2

Gene Name

clp-1

Worm Base

Allele Name

tm690

Gene Name

clp-1

Sequence

C06G4.2

Phenotype

homozygous viable. Dr. M. Driscoll: No effect found on necrotic cell death. Dr. N. Tavernarakis: normal development, normal locomotion, normal body size/shape, normal brood size.

Mutation site

7031/7032-7655/7656 (624 bp deletion)

Chromosome

III

Putative gene structure

join(4799..4874, 5795..5923, 5971..6413, 6456..6614, 6685..6947, 7008..7139, 7514..7983, 8028..8104, 8729..8818, 8865..8987)

Map position

-0.45

Balancer

Map position of balancer

Sequence of primers

ExtFwd:CAATGATATCGGTGGACTCA,IntFwd:TCATCAACAGTATGGGAGGT,IntRev:GGCCTTGACACCAGTCATTT,ExtRev:CAAACCATTCCAGCGGCCTT

Distributed lab

Depositor

Dr. S. Mitani/NBRP

References

Please submit your publication

Mazzetto M, Gonzalez LE, Sanchez N, Reinke V.
Characterization of the distribution and dynamics of chromatin states in the C. elegans germline reveals substantial H3K4me3 remodeling during oogenesis.
Genome Res 2024 34(1) 57-69
[ PubMed ID = 38164610 ] [ RRC reference ]

Kim BS, Alcantara AV Jr, Moon JH, Higashitani A, Higashitani N, Etheridge T, Szewczyk NJ, Deane CS, Gaffney CJ, Higashibata A, Hashizume T, Yoon KH, Lee JI.
Comparative Analysis of Muscle Atrophy During Spaceflight, Nutritional Deficiency and Disuse in the Nematode Caenorhabditis elegans.
Int J Mol Sci 2023 24(16)
[ PubMed ID = 37628820 ] [ RRC reference ]

Ellwood RA, Piasecki M, Szewczyk NJ.
Caenorhabditis elegans as a Model System for Duchenne Muscular Dystrophy.
Int J Mol Sci 2021 22(9)
[ PubMed ID = 34063069 ] [ RRC reference ]

Gallud A, Klöditz K, Ytterberg J, Östberg N, Katayama S, Skoog T, Gogvadze V, Chen YZ, Xue D, Moya S, Ruiz J, Astruc D, Zubarev R, Kere J, Fadeel B.
Cationic gold nanoparticles elicit mitochondrial dysfunction: a multi-omics study.
Sci Rep 2019 9(1) 4366
[ PubMed ID = 30867451 ] [ RRC reference ]

Galimov ER, Pryor RE, Poole SE, Benedetto A, Pincus Z, Gems D.
Coupling of Rigor Mortis and Intestinal Necrosis during C. elegans Organismal Death.
Cell Rep 2018 22(10) 2730-2741
[ PubMed ID = 29514100 ] [ RRC reference ]

Geng X, Harry BL, Zhou Q, Skeen-Gaar RR, Ge X, Lee ES, Mitani S, Xue D.
Hepatitis B virus X protein targets the Bcl-2 protein CED-9 to induce intracellular Ca2+ increase and cell death in Caenorhabditis elegans.
Proc Natl Acad Sci U S A 2012 109(45) 18465-70
[ PubMed ID = 23091037 ] [ RRC reference ]

Kourtis N, Nikoletopoulou V, Tavernarakis N.
Small heat-shock proteins protect from heat-stroke-associated neurodegeneration.
Nature 2012 490(7419) 213-8
[ PubMed ID = 22972192 ] [ RRC reference ]

Joyce PI, Satija R, Chen M, Kuwabara PE.
The atypical calpains: evolutionary analyses and roles in Caenorhabditis elegans cellular degeneration.
PLoS Genet 2012 8(3) e1002602
[ PubMed ID = 22479198 ] [ RRC reference ]

Mano I, Driscoll M.
Caenorhabditis elegans glutamate transporter deletion induces AMPA-receptor/adenylyl cyclase 9-dependent excitotoxicity.
J Neurochem 2009 108(6) 1373-84
[ PubMed ID = 19054279 ] [ RRC reference ]