分離済み変異体

tm690

Allele Nametm690
BalanceNot Required
OutCrossNot Accepted
Sequence NameC06G4.2
Gene Nameclp-1
Worm BaseAllele Name tm690
Gene Name clp-1
Sequence C06G4.2
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable. Dr. M. Driscoll: No effect found on necrotic cell death. Dr. N. Tavernarakis: normal development, normal locomotion, normal body size/shape, normal brood size.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 7031/7032-7655/7656 (624 bp deletion)
ChromosomeIII
Putative gene structurejoin(4799..4874, 5795..5923, 5971..6413, 6456..6614, 6685..6947, 7008..7139, 7514..7983, 8028..8104, 8729..8818, 8865..8987)
Map position-0.45
Balancer
Map position of balancer
Sequence of primersExtFwd:CAATGATATCGGTGGACTCA,IntFwd:TCATCAACAGTATGGGAGGT,IntRev:GGCCTTGACACCAGTCATTT,ExtRev:CAAACCATTCCAGCGGCCTT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Mazzetto M, Gonzalez LE, Sanchez N, Reinke V.
Characterization of the distribution and dynamics of chromatin states in the C. elegans germline reveals substantial H3K4me3 remodeling during oogenesis.
Genome Res 2024 34(1) 57-69 
[ PubMed ID = 38164610 ] [ RRC reference ]

Kim BS, Alcantara AV Jr, Moon JH, Higashitani A, Higashitani N, Etheridge T, Szewczyk NJ, Deane CS, Gaffney CJ, Higashibata A, Hashizume T, Yoon KH, Lee JI.
Comparative Analysis of Muscle Atrophy During Spaceflight, Nutritional Deficiency and Disuse in the Nematode Caenorhabditis elegans.
Int J Mol Sci 2023 24(16)  
[ PubMed ID = 37628820 ] [ RRC reference ]

Ellwood RA, Piasecki M, Szewczyk NJ.
Caenorhabditis elegans as a Model System for Duchenne Muscular Dystrophy.
Int J Mol Sci 2021 22(9)  
[ PubMed ID = 34063069 ] [ RRC reference ]

Gallud A, Klöditz K, Ytterberg J, Östberg N, Katayama S, Skoog T, Gogvadze V, Chen YZ, Xue D, Moya S, Ruiz J, Astruc D, Zubarev R, Kere J, Fadeel B.
Cationic gold nanoparticles elicit mitochondrial dysfunction: a multi-omics study.
Sci Rep 2019 9(1) 4366 
[ PubMed ID = 30867451 ] [ RRC reference ]

Galimov ER, Pryor RE, Poole SE, Benedetto A, Pincus Z, Gems D.
Coupling of Rigor Mortis and Intestinal Necrosis during C. elegans Organismal Death.
Cell Rep 2018 22(10) 2730-2741 
[ PubMed ID = 29514100 ] [ RRC reference ]

Geng X, Harry BL, Zhou Q, Skeen-Gaar RR, Ge X, Lee ES, Mitani S, Xue D.
Hepatitis B virus X protein targets the Bcl-2 protein CED-9 to induce intracellular Ca2+ increase and cell death in Caenorhabditis elegans.
Proc Natl Acad Sci U S A 2012 109(45) 18465-70 
[ PubMed ID = 23091037 ] [ RRC reference ]

Kourtis N, Nikoletopoulou V, Tavernarakis N.
Small heat-shock proteins protect from heat-stroke-associated neurodegeneration.
Nature 2012 490(7419) 213-8 
[ PubMed ID = 22972192 ] [ RRC reference ]

Joyce PI, Satija R, Chen M, Kuwabara PE.
The atypical calpains: evolutionary analyses and roles in Caenorhabditis elegans cellular degeneration.
PLoS Genet 2012 8(3) e1002602 
[ PubMed ID = 22479198 ] [ RRC reference ]

Mano I, Driscoll M.
Caenorhabditis elegans glutamate transporter deletion induces AMPA-receptor/adenylyl cyclase 9-dependent excitotoxicity.
J Neurochem 2009 108(6) 1373-84 
[ PubMed ID = 19054279 ] [ RRC reference ]