分離済み変異体

tm688

Allele Nametm688
Allele Type通常株
Sequence NameC05D10.3
Gene Namewht-1
Worm BaseAllele Name tm688
Gene Name wht-1
Sequence C05D10.3
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable. Dr.M. Hengartner: no suppression over ced-10(n1993).
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 20257/20258-TTAAAA-20771/20772 (514 bp deletion + 6 bp insertion)
ChromosomeIII
Putative gene structurecomplement(join(18149..18221, 18489..18545, 18588..18741, 18800..19028, 19073..19204, 19248..19353, 19549..19685, 19729..19903, 19948..20047, 20243..20555, 20599..20802))
Map position-1.42
Balancer
Map position of balancer
Sequence of primersExtRev:CGTCACAGGACCTGAAACGA,ExtFwd:AGCTGTCATCTCACAGGTCA,IntRev:CGAAACCCACCAACTTCGTA,IntFwd:GGTCAAACTGAGCACAGCTT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Levitte S, Salesky R, King B, Coe Smith S, Depper M, Cole M, Hermann GJ.
A Caenorhabditis elegans model of orotic aciduria reveals enlarged lysosome-related organelles in embryos lacking umps-1 function.
FEBS J 2010 277(6) 1420-39 
[ PubMed ID = 20148972 ] [ RRC reference ]

C. elegans Deletion Mutant Consortium.
large-scale screening for targeted knockouts in the Caenorhabditis elegans genome.
G3 (Bethesda) 2012 2(11) 1415-25 
[ PubMed ID = 23173093 ] [ RRC reference ]

Sundaram P, Han W, Cohen N, Echalier B, Albin J, Timmons L.
Caenorhabditis elegans ABCRNAi transporters interact genetically with rde-2 and mut-7.
Genetics 2008 178(2) 801-14 
[ PubMed ID = 18245353 ] [ RRC reference ]

Currie E, King B, Lawrenson AL, Schroeder LK, Kershner AM, Hermann GJ.
Role of the Caenorhabditis elegans multidrug resistance gene, mrp-4, in gut granule differentiation.
Genetics 2007 177(3) 1569-82 
[ PubMed ID = 17947407 ] [ RRC reference ]

Sundaram P, Echalier B, Han W, Hull D, Timmons L.
ATP-binding cassette transporters are required for efficient RNA interference in Caenorhabditis elegans.
Mol Biol Cell 2006 17(8) 3678-88 
[ PubMed ID = 16723499 ] [ RRC reference ]