Allele Name | tm688 |
Allele Type | 通常株 |
Sequence Name | C05D10.3 |
Gene Name | wht-1 |
Worm Base | Allele Name |
tm688
|
Gene Name |
wht-1
|
Sequence |
C05D10.3
|
Phenotype
Information from the receiver is posted in the form of a "researcher : phenotype"
| homozygous viable. Dr.M. Hengartner: no suppression over ced-10(n1993). |
Mutation site
Please see gene structure to locate the deletion in relation to exon(s)
| 20257/20258-TTAAAA-20771/20772 (514 bp deletion + 6 bp insertion) |
Chromosome | III |
Putative gene structure | complement(join(18149..18221, 18489..18545, 18588..18741, 18800..19028, 19073..19204, 19248..19353, 19549..19685, 19729..19903, 19948..20047, 20243..20555, 20599..20802)) |
Map position | -1.42 |
Balancer | |
Map position of balancer | |
Sequence of primers | ExtRev:CGTCACAGGACCTGAAACGA,ExtFwd:AGCTGTCATCTCACAGGTCA,IntRev:CGAAACCCACCAACTTCGTA,IntFwd:GGTCAAACTGAGCACAGCTT |
Distributed lab | |
Depositor | Dr. S. Mitani/NBRP |
References |
Please submit your publication
Levitte S, Salesky R, King B, Coe Smith S, Depper M, Cole M, Hermann GJ. A Caenorhabditis elegans model of orotic aciduria reveals enlarged lysosome-related organelles in embryos lacking umps-1 function. FEBS J 2010 277(6) 1420-39
[ PubMed ID = 20148972 ]
[ RRC reference ]
|
C. elegans Deletion Mutant Consortium. large-scale screening for targeted knockouts in the Caenorhabditis elegans genome. G3 (Bethesda) 2012 2(11) 1415-25
[ PubMed ID = 23173093 ]
[ RRC reference ]
|
Sundaram P, Han W, Cohen N, Echalier B, Albin J, Timmons L. Caenorhabditis elegans ABCRNAi transporters interact genetically with rde-2 and mut-7. Genetics 2008 178(2) 801-14
[ PubMed ID = 18245353 ]
[ RRC reference ]
|
Currie E, King B, Lawrenson AL, Schroeder LK, Kershner AM, Hermann GJ. Role of the Caenorhabditis elegans multidrug resistance gene, mrp-4, in gut granule differentiation. Genetics 2007 177(3) 1569-82
[ PubMed ID = 17947407 ]
[ RRC reference ]
|
Sundaram P, Echalier B, Han W, Hull D, Timmons L. ATP-binding cassette transporters are required for efficient RNA interference in Caenorhabditis elegans. Mol Biol Cell 2006 17(8) 3678-88
[ PubMed ID = 16723499 ]
[ RRC reference ]
|
|