分離済み変異体

tm678

Allele Nametm678
BalanceNot Required
OutCrossNot Accepted
Sequence NameB0041.7
Gene Namexnp-1
Worm BaseAllele Name tm678
Gene Name xnp-1
Sequence B0041.7
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable. Dr. J. Ewbank: Dev. Biol. 278, 49 (2005), Dr. D. Fay: Dev. Biol. 273, 335 (2004).
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 27232/27233-27905/27906 (673 bp deletion)
ChromosomeI
Putative gene structurecomplement(join(23009..23158, 23264..24062, 24581..24814, 24875..25572, 26090..26265, 26324..26602, 26655..27655, 27721..28287, 28342..28482, 28543..28577))
Map position-1.02
Balancer
Map position of balancer
Sequence of primersExtRev:CTAATGAGAGTTGGTGTCAG,IntFwd:GGTGAGCACACGATAATCTT,ExtFwd:GCTTTGGTGGAATCGCTTCG,IntRev:AGTCGGAGGATTCCGAGTAA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Mazzetto M, Gonzalez LE, Sanchez N, Reinke V.
Characterization of the distribution and dynamics of chromatin states in the C. elegans germline reveals substantial H3K4me3 remodeling during oogenesis.
Genome Res 2024 34(1) 57-69 
[ PubMed ID = 38164610 ] [ RRC reference ]

Huang J, Wu Z, Zhang X.
Short-Term Mild Temperature-Stress-Induced Alterations in the C. elegans Phosphoproteome.
Int J Mol Sci 2020 21(17)  
[ PubMed ID = 32899194 ] [ RRC reference ]

Cox-Paulson EA, Grana TM, Harris MA, Batzli JM.
Studying human disease genes in Caenorhabditis elegans: a molecular genetics laboratory project.
CBE Life Sci Educ 2012 11(2) 165-79 
[ PubMed ID = 22665589 ] [ RRC reference ]

Lans H, Marteijn JA, Schumacher B, Hoeijmakers JH, Jansen G, Vermeulen W.
Involvement of global genome repair, transcription coupled repair, and chromatin remodeling in UV DNA damage response changes during development.
PLoS Genet 2010 6(5) e1000941 
[ PubMed ID = 20463888 ] [ RRC reference ]

Chesney MA, Kidd AR 3rd, Kimble J.
gon-14 functions with class B and class C synthetic multivulva genes to control larval growth in Caenorhabditis elegans.
Genetics 2006 172(2) 915-28 
[ PubMed ID = 16322520 ] [ RRC reference ]

Cardoso C, Couillault C, Mignon-Ravix C, Millet A, Ewbank JJ, Fontés M, Pujol N.
XNP-1/ATR-X acts with RB, HP1 and the NuRD complex during larval development in C. elegans.
Dev Biol 2005 278(1) 49-59 
[ PubMed ID = 15649460 ] [ RRC reference ]

Bender AM, Wells O, Fay DS.
lin-35/Rb and xnp-1/ATR-X function redundantly to control somatic gonad development in C. elegans.
Dev Biol 2004 273(2) 335-49 
[ PubMed ID = 15328017 ] [ RRC reference ]