| Allele Name | tm678 |
| Balance | Not Required |
| OutCross | Not Accepted |
| Sequence Name | B0041.7 |
| Gene Name | xnp-1 |
| Worm Base | Allele Name |
tm678
|
| Gene Name |
xnp-1
|
| Sequence |
B0041.7
|
Phenotype
Information from the receiver is posted in the form
of a "researcher : phenotype"
| homozygous viable. Dr. J. Ewbank: Dev. Biol. 278, 49 (2005), Dr. D. Fay: Dev. Biol. 273, 335 (2004). |
|
Mutation site
Please see gene structure to locate the deletion in
relation to exon(s)
| 27232/27233-27905/27906 (673 bp deletion) |
| Chromosome | I |
| Putative gene structure | complement(join(23009..23158, 23264..24062, 24581..24814, 24875..25572, 26090..26265, 26324..26602, 26655..27655, 27721..28287, 28342..28482, 28543..28577)) |
| Map position | -1.02 |
| Balancer | |
| Map position of balancer | |
| Sequence of primers | ExtRev:CTAATGAGAGTTGGTGTCAG,IntFwd:GGTGAGCACACGATAATCTT,ExtFwd:GCTTTGGTGGAATCGCTTCG,IntRev:AGTCGGAGGATTCCGAGTAA |
| Distributed lab | |
| Depositor | Dr. S. Mitani/NBRP |
| References |
Please submit your publication
Mazzetto M, Gonzalez LE, Sanchez N, Reinke V.
Characterization of the distribution and dynamics of chromatin states in the C. elegans germline reveals substantial H3K4me3 remodeling during oogenesis.
Genome Res 2024 34(1) 57-69
[ PubMed ID = 38164610 ]
[ RRC reference ]
|
Huang J, Wu Z, Zhang X.
Short-Term Mild Temperature-Stress-Induced Alterations in the C. elegans Phosphoproteome.
Int J Mol Sci 2020 21(17)
[ PubMed ID = 32899194 ]
[ RRC reference ]
|
Cox-Paulson EA, Grana TM, Harris MA, Batzli JM.
Studying human disease genes in Caenorhabditis elegans: a molecular genetics laboratory project.
CBE Life Sci Educ 2012 11(2) 165-79
[ PubMed ID = 22665589 ]
[ RRC reference ]
|
Lans H, Marteijn JA, Schumacher B, Hoeijmakers JH, Jansen G, Vermeulen W.
Involvement of global genome repair, transcription coupled repair, and chromatin remodeling in UV DNA damage response changes during development.
PLoS Genet 2010 6(5) e1000941
[ PubMed ID = 20463888 ]
[ RRC reference ]
|
Chesney MA, Kidd AR 3rd, Kimble J.
gon-14 functions with class B and class C synthetic multivulva genes to control larval growth in Caenorhabditis elegans.
Genetics 2006 172(2) 915-28
[ PubMed ID = 16322520 ]
[ RRC reference ]
|
Cardoso C, Couillault C, Mignon-Ravix C, Millet A, Ewbank JJ, Fontés M, Pujol N.
XNP-1/ATR-X acts with RB, HP1 and the NuRD complex during larval development in C. elegans.
Dev Biol 2005 278(1) 49-59
[ PubMed ID = 15649460 ]
[ RRC reference ]
|
Bender AM, Wells O, Fay DS.
lin-35/Rb and xnp-1/ATR-X function redundantly to control somatic gonad development in C. elegans.
Dev Biol 2004 273(2) 335-49
[ PubMed ID = 15328017 ]
[ RRC reference ]
|
|
Copyright © 2009 NBRP-C. elegans. All rights reserved.