分離済み変異体

tm668

Allele Nametm668
BalanceNot Required
OutCrossNot Accepted
Sequence NameH15N14.1d
Gene Nameadr-1
Worm BaseAllele Name tm668
Gene Name adr-1
Sequence H15N14.1d
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable. Dr. H. Sawa: Pvul, Egl.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 3992/3993-4959/4960 (967 bp deletion)
ChromosomeI
Putative gene structurejoin(3232..3306, 3807..3875, 3927..4064, 4192..4389, 4437..4537, 4589..4835, 4887..4946, 4996..5527, 5577..5838, 5911..6180, 6228..6554, 6606..7125, 7183..7263)
Map position2.35
Balancer
Map position of balancer
Sequence of primersIntFwd:GCTGGCTACCCACACGGTAT,IntRev:GCATCTGTTTTCACACAGGA,ExtFwd:TACAACTGGGCAAGTCAATG,ExtRev:AGAGCACACGGTCCCTGACT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Pan P, Zoberman M, Zhang P, Premachandran S, Bhatnagar S, Pilaka-Akella PP, Sun W, Li C, Martin C, Xu P, Zhang Z, Li R, Hung W, Tang H, MacGillivray K, Yu B, Zuo R, Pe K, Qin Z, Wang S, Li A, Derry WB, Zhen M, Saltzman AL, Calarco JA, Liu X.
Robotic microinjection enables large-scale transgenic studies of Caenorhabditis elegans.
Nat Commun 2024 15(1) 8848 
[ PubMed ID = 39397017 ] [ RRC reference ]

Cornwell AB, Zhang Y, Thondamal M, Johnson DW, Thakar J, Samuelson AV.
The C. elegans Myc-family of transcription factors coordinate a dynamic adaptive response to dietary restriction.
Geroscience 2024 46(5) 4827-4854 
[ PubMed ID = 38878153 ] [ RRC reference ]

Eliad B, Schneider N, Ben-Naim Zgayer O, Amichan Y, Glaser F, Erdmann EA, Rajendren S, Hundley HA, Lamm AT.
ADBP-1 regulates ADR-2 nuclear localization to control editing substrate selection.
Nucleic Acids Res 2024 52(16) 9501-9518 
[ PubMed ID = 39036970 ] [ RRC reference ]

Dhakal A, Salim C, Skelly M, Amichan Y, Lamm AT, Hundley HA.
ADARs regulate cuticle collagen expression and promote survival to pathogen infection.
BMC Biol 2024 22(1) 37 
[ PubMed ID = 38360623 ] [ RRC reference ]

Cornwell A, Zhang Y, Thondamal M, Johnson DW, Thakar J, Samuelson AV.
The C. elegans Myc-family of transcription factors coordinate a dynamic adaptive response to dietary restriction.
bioRxiv 2023   
[ PubMed ID = 38045350 ] [ RRC reference ]

Braun M, Shoshani S, Teixeira J, Mellul Shtern A, Miller M, Granot Z, Fischer SEJ, Garcia SMDA, Tabach Y.
Asymmetric inheritance of RNA toxicity in C. elegans expressing CTG repeats.
iScience 2022 25(5) 104246 
[ PubMed ID = 35494247 ] [ RRC reference ]

Knupp D, Jorgensen BG, Alshareef HZ, Bhat JM, Grubbs JJ, Miura P, van der Linden AM.
Loss of circRNAs from the crh-1 gene extends the mean lifespan in Caenorhabditis elegans.
Aging Cell 2022 21(2) e13560 
[ PubMed ID = 35102684 ] [ RRC reference ]

Arribere JA, Kuroyanagi H, Hundley HA.
mRNA Editing, Processing and Quality Control in Caenorhabditis elegans.
Genetics 2020 215(3) 531-568 
[ PubMed ID = 32632025 ] [ RRC reference ]

Fischer SEJ, Ruvkun G.
Caenorhabditis elegans ADAR editing and the ERI-6/7/MOV10 RNAi pathway silence endogenous viral elements and LTR retrotransposons.
Proc Natl Acad Sci U S A 2020 117(11) 5987-5996 
[ PubMed ID = 32123111 ] [ RRC reference ]

Ganem NS, Ben-Asher N, Manning AC, Deffit SN, Washburn MC, Wheeler EC, Yeo GW, Zgayer OB, Mantsur E, Hundley HA, Lamm AT.
Disruption in A-to-I Editing Levels Affects C. elegans Development More Than a Complete Lack of Editing.
Cell Rep 2019 27(4) 1244-1253.e4 
[ PubMed ID = 31018137 ] [ RRC reference ]

Reich DP, Tyc KM, Bass BL.
C. elegans ADARs antagonize silencing of cellular dsRNAs by the antiviral RNAi pathway.
Genes Dev 2018 32(3-4) 271-282 
[ PubMed ID = 29483152 ] [ RRC reference ]

Deffit SN, Yee BA, Manning AC, Rajendren S, Vadlamani P, Wheeler EC, Domissy A, Washburn MC, Yeo GW, Hundley HA.
The C. elegans neural editome reveals an ADAR target mRNA required for proper chemotaxis.
Elife 2017 6  
[ PubMed ID = 28925356 ] [ RRC reference ]

Goldstein B, Agranat-Tamir L, Light D, Ben-Naim Zgayer O, Fishman A, Lamm AT.
A-to-I RNA editing promotes developmental stage-specific gene and lncRNA expression.
Genome Res 2017 27(3) 462-470 
[ PubMed ID = 28031250 ] [ RRC reference ]

Washburn MC, Hundley HA.
Trans and cis factors affecting A-to-I RNA editing efficiency of a noncoding editing target in C. elegans.
RNA 2016 22(5) 722-8 
[ PubMed ID = 26917557 ] [ RRC reference ]

Wheeler EC, Washburn MC, Major F, Rusch DB, Hundley HA.
Noncoding regions of C. elegans mRNA undergo selective adenosine to inosine deamination and contain a small number of editing sites per transcript.
RNA Biol 2015 12(2) 162-74 
[ PubMed ID = 25826568 ] [ RRC reference ]

Washburn MC, Kakaradov B, Sundararaman B, Wheeler E, Hoon S, Yeo GW, Hundley HA.
The dsRBP and inactive editor ADR-1 utilizes dsRNA binding to regulate A-to-I RNA editing across the C. elegans transcriptome.
Cell Rep 2014 6(4) 599-607 
[ PubMed ID = 24508457 ] [ RRC reference ]

Warf MB, Shepherd BA, Johnson WE, Bass BL.
Effects of ADARs on small RNA processing pathways in C. elegans.
Genome Res 2012 22(8) 1488-98 
[ PubMed ID = 22673872 ] [ RRC reference ]

Wu D, Lamm AT, Fire AZ.
Competition between ADAR and RNAi pathways for an extensive class of RNA targets.
Nat Struct Mol Biol 2011 18(10) 1094-101 
[ PubMed ID = 21909095 ] [ RRC reference ]

Hundley HA, Krauchuk AA, Bass BL.
C. elegans and H. sapiens mRNAs with edited 3' UTRs are present on polysomes.
RNA 2008 14(10) 2050-60 
[ PubMed ID = 18719245 ] [ RRC reference ]