| Allele Name | tm6649 |
| Balance | Not Required |
| OutCross | Not Accepted |
| Sequence Name | F49E7.1 |
| Gene Name | rme-6 |
| Worm Base | Allele Name |
tm6649
|
| Gene Name |
rme-6
|
| Sequence |
F49E7.1
|
Phenotype
Information from the receiver is posted in the form
of a "researcher : phenotype"
| homozygous viable. |
Mutation site
Please see gene structure to locate the deletion in
relation to exon(s)
| 9297/9298-TG-9687/9688 (390 bp deletion + 2 bp insertion) |
| Chromosome | X |
| Putative gene structure | join(8167..8268, 8324..8410, 8455..8552, 8910..9012, 9056..9358, 9654..9762, 9815..10131, 10180..10335, 10665..10833, 10882..11316, 11581..11920, 11967..12194, 12483..12617, 12669..12894, 12942..13057, 13512..13584, 13660..13857, 14059..14193) |
| Map position | -18.73 |
| Balancer | |
| Map position of balancer | |
| Sequence of primers | ExtFwd:ATCGAGCGGATTCGGTCTCA,IntFwd:CAGGACGAGTATCGGGAGTT,ExtRev:GTTAACATCCGCCACAGTTC,IntRev:CTCGATTTCGTAGCCATATC |
| Distributed lab | |
| Depositor | Dr. S. Mitani/NBRP |
| References |
Please submit your publication
McDiarmid TA, Belmadani M, Liang J, Meili F, Mathews EA, Mullen GP, Hendi A, Wong WR, Rand JB, Mizumoto K, Haas K, Pavlidis P, Rankin CH. Systematic phenomics analysis of autism-associated genes reveals parallel networks underlying reversible impairments in habituation. Proc Natl Acad Sci U S A 2020 117(1) 656-667
[ PubMed ID = 31754030 ]
[ RRC reference ]
|
|