| Allele Name | tm663 |
| Balance | Not Required |
| OutCross | Not Accepted |
| Sequence Name | C05A9.1 |
| Gene Name | pgp-5 |
| Worm Base | Allele Name |
tm663
|
| Gene Name |
pgp-5
|
| Sequence |
C05A9.1
|
Phenotype
Information from the receiver is posted in the form
of a "researcher : phenotype"
| homozygous viable |
|
Mutation site
Please see gene structure to locate the deletion in
relation to exon(s)
| 30908/30909-AATAA-31540/31541 (632 bp deletion + 5 bp insertion) |
| Chromosome | X |
| Putative gene structure | complement(join(28410..28772, 28829..29032, 29079..29543, 29589..29717, 29768..29872, 29919..30281, 30327..30595, 30642..30741, 30790..30879, 30927..31538, 31781..31894, 31941..32112, 32154..32450, 32496..32629, 32676..32785, 32881..33205)) |
| Map position | 2.57 |
| Balancer | |
| Map position of balancer | |
| Sequence of primers | ExtRev:AGATTGGCGACTTGCTTGCT,ExtFwd:AACACTACCAAGGCGATCGT,IntRev:CTACGGAACTGTGTTTTCGT,IntFwd:TCCACTGCAGCAGTGACATT |
| Distributed lab | |
| Depositor | Dr. S. Mitani/NBRP |
| References |
Please submit your publication
C. elegans Deletion Mutant Consortium.
large-scale screening for targeted knockouts in the Caenorhabditis elegans genome.
G3 (Bethesda) 2012 2(11) 1415-25
[ PubMed ID = 23173093 ]
[ RRC reference ]
|
Sundaram P, Han W, Cohen N, Echalier B, Albin J, Timmons L.
Caenorhabditis elegans ABCRNAi transporters interact genetically with rde-2 and mut-7.
Genetics 2008 178(2) 801-14
[ PubMed ID = 18245353 ]
[ RRC reference ]
|
|
Copyright © 2009 NBRP-C. elegans. All rights reserved.