分離済み変異体

tm659

Allele Name

tm659

Allele Type

通常株

Sequence Name

C41C4.8

Gene Name

cdc-48.2

Worm Base

Allele Name

tm659

Gene Name

cdc-48.2

Sequence

C41C4.8

Phenotype

homozygous viable. Dr. T. Schedl: no germline phenotype, although smaller brood size (180-200/mom). Dr. T. Ogura: BBRC 345, 746-753 (2006). Genes to Cells: 12, 1063 (2007). Dr. A. Colavita: no VC neuron axon branching defects. Dr. T. Hoppe: J. Struct. Biol. 156, 41 (2006), Nat. Cell Biol. 9, 379 (2007).

Mutation site

[F10B5] 879/880-[F10B5] 1518/1519 (639 bp deletion)

Chromosome

Putative gene structure

join(39039..39110,39159..39484,39531..39750, Z48334.1:100..855, Z48334.1:908..1626, Z48334.1:1686..2025)

Map position

0.71

Balancer

Map position of balancer

Sequence of primers

ExtFwd:TTTAACCATGGCCTCAGTTC,IntFwd:CCGACTCAGAGAGACGAGAA,ExtRev:TTCAAATCGAGATCGGCGGA,IntRev:GTTTTGCGGAGTGAGGCCTT

Distributed lab

Depositor

Dr. S. Mitani

References

Please submit your publication

Taouktsi E, Kyriakou E, Voulgaraki E, Verganelakis D, Krokou S, Rigas S, Voutsinas GE, Syntichaki P.
Mitochondrial p38 Mitogen-Activated Protein Kinase: Insights into Its Regulation of and Role in LONP1-Deficient Nematodes.
Int J Mol Sci 2023 24(24)
[ PubMed ID = 38139038 ] [ RRC reference ]

Kumar AV, Mills J, Parker WM, Leitão JA, Rodriguez DI, Daigle SE, Ng C, Patel R, Aguilera JL, Johnson JR, Wong SQ, Lapierre LR.
Lipid droplets modulate proteostasis, SQST-1/SQSTM1 dynamics, and lifespan in C. elegans.
iScience 2023 26(10) 107960
[ PubMed ID = 37810233 ] [ RRC reference ]

Kim S, Shin HJ, Do SH, Na HS.
Role of Unfolded Protein Response and Endoplasmic Reticulum-Associated Degradation by Repeated Exposure to Inhalation Anesthetics in Caenorhabditis elegans.
Int J Med Sci 2021 18(13) 2890-2896
[ PubMed ID = 34220315 ] [ RRC reference ]

Cheung TP, Choe JY, Richmond JE, Kim H.
BK channel density is regulated by endoplasmic reticulum associated degradation and influenced by the SKN-1A/NRF1 transcription factor.
PLoS Genet 2020 16(6) e1008829
[ PubMed ID = 32502151 ] [ RRC reference ]

Franz A, Pirson PA, Pilger D, Halder S, Achuthankutty D, Kashkar H, Ramadan K, Hoppe T.
Chromatin-associated degradation is defined by UBXN-3/FAF1 to safeguard DNA replication fork progression.
Nat Commun 2016 7 10612
[ PubMed ID = 26842564 ] [ RRC reference ]

Martínez-Velázquez LA, Ringstad N.
Antagonistic regulation of trafficking to Caenorhabditis elegans sensory cilia by a Retinal Degeneration 3 homolog and retromer.
Proc Natl Acad Sci U S A 2018 115(3) E438-E447
[ PubMed ID = 29282322 ] [ RRC reference ]

Sasagawa Y, Yamanaka K, Saito-Sasagawa Y, Ogura T.
Caenorhabditis elegans UBX cofactors for CDC-48/p97 control spermatogenesis.
Genes Cells 2010 15(12) 1201-15
[ PubMed ID = 20977550 ] [ RRC reference ]

Kuhlbrodt K, Janiesch PC, Kevei É, Segref A, Barikbin R, Hoppe T.
The Machado-Joseph disease deubiquitylase ATX-3 couples longevity and proteostasis.
Nat Cell Biol 2011 13(3) 273-81
[ PubMed ID = 21317884 ] [ RRC reference ]

Liu G, Rogers J, Murphy CT, Rongo C.
EGF signalling activates the ubiquitin proteasome system to modulate C. elegans lifespan.
EMBO J 2011 30(15) 2990-3003
[ PubMed ID = 21673654 ] [ RRC reference ]

Zou CG, Ma YC, Dai LL, Zhang KQ.
Autophagy protects C. elegans against necrosis during Pseudomonas aeruginosa infection.
Proc Natl Acad Sci U S A 2014 111(34) 12480-5
[ PubMed ID = 25114220 ] [ RRC reference ]

Marza E, Taouji S, Barroso K, Raymond AA, Guignard L, Bonneu M, Pallares-Lupon N, Dupuy JW, Fernandez-Zapico ME, Rosenbaum J, Palladino F, Dupuy D, Chevet E.
Genome-wide screen identifies a novel p97/CDC-48-dependent pathway regulating ER-stress-induced gene transcription.
EMBO Rep 2015 16(3) 332-40
[ PubMed ID = 25652260 ] [ RRC reference ]

Jablonski AM, Lamitina T, Liachko NF, Sabatella M, Lu J, Zhang L, Ostrow LW, Gupta P, Wu CY, Doshi S, Mojsilovic-Petrovic J, Lans H, Wang J, Kraemer B, Kalb RG.
Loss of RAD-23 Protects Against Models of Motor Neuron Disease by Enhancing Mutant Protein Clearance.
J Neurosci 2015 35(42) 14286-306
[ PubMed ID = 26490867 ] [ RRC reference ]

Sasagawa Y, Otani M, Higashitani N, Higashitani A, Sato K, Ogura T, Yamanaka K.
Caenorhabditis elegans p97 controls germline-specific sex determination by controlling the TRA-1 level in a CUL-2-dependent manner.
J Cell Sci 2009 122(Pt 20) 3663-72
[ PubMed ID = 19773360 ] [ RRC reference ]

Arur S, Ohmachi M, Nayak S, Hayes M, Miranda A, Hay A, Golden A, Schedl T.
Multiple ERK substrates execute single biological processes in Caenorhabditis elegans germ-line development.
Proc Natl Acad Sci U S A 2009 106(12) 4776-81
[ PubMed ID = 19264959 ] [ RRC reference ]

Rodrigues AJ, Neves-Carvalho A, Ferro A, Rokka A, Corthals G, Logarinho E, Maciel P.
ATX-3, CDC-48 and UBXN-5: a new trimolecular complex in Caenorhabditis elegans.
Biochem Biophys Res Commun 2009 386(4) 575-81
[ PubMed ID = 19545544 ] [ RRC reference ]

Janiesch PC, Kim J, Mouysset J, Barikbin R, Lochmüller H, Cassata G, Krause S, Hoppe T.
The ubiquitin-selective chaperone CDC-48/p97 links myosin assembly to human myopathy.
Nat Cell Biol 2007 9(4) 379-90
[ PubMed ID = 17369820 ] [ RRC reference ]

Sasagawa Y, Yamanaka K, Ogura T.
ER E3 ubiquitin ligase HRD-1 and its specific partner chaperone BiP play important roles in ERAD and developmental growth in Caenorhabditis elegans.
Genes Cells 2007 12(9) 1063-73
[ PubMed ID = 17825049 ] [ RRC reference ]

Yamauchi S, Yamanaka K, Ogura T.
Comparative analysis of expression of two p97 homologues in Caenorhabditis elegans.
Biochem Biophys Res Commun 2006 345(2) 746-53
[ PubMed ID = 16701565 ] [ RRC reference ]

Mouysset J, Kähler C, Hoppe T.
A conserved role of Caenorhabditis elegans CDC-48 in ER-associated protein degradation.
J Struct Biol 2006 156(1) 41-9
[ PubMed ID = 16647269 ] [ RRC reference ]