分離済み変異体

tm655

Allele Nametm655
BalanceCompleted
OutCrossNot Accepted
Sequence NameF48E8.5
Gene Namepaa-1
Worm BaseAllele Name tm655 (x1)
Gene Name paa-1
Sequence F48E8.5
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" lethal or sterile. Dr. M. Jantsch: no meiotic phenotype.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 7768/7769-9196/9197 (1428 bp deletion)
ChromosomeIII
Putative gene structurejoin(6868..6983, 7253..7347, 7498..8017, 8069..8928, 8976..9193, 9247..9326, 9371..9462, 9517..9530)
Map position-1.72
BalancerqC1 [e1259 q339 qIs26],hT2
Map position of balancer
Sequence of primersIntRev:CTTCAAACTCTTTGCGGCGT,IntFwd:GGATTGTGCTATTGCAGTGA,ExtFwd:ATGAGAGCTCTACGACCGCA,ExtRev:TTCCTGTCACCTTGGGGTCA
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Song MH, Liu Y, Anderson DE, Jahng WJ, O'Connell KF.
Protein phosphatase 2A-SUR-6/B55 regulates centriole duplication in C. elegans by controlling the levels of centriole assembly factors.
Dev Cell 2011 20(4) 563-71 
[ PubMed ID = 21497766 ] [ RRC reference ]

Ogura K, Okada T, Mitani S, Gengyo-Ando K, Baillie DL, Kohara Y, Goshima Y.
Protein phosphatase 2A cooperates with the autophagy-related kinase UNC-51 to regulate axon guidance in Caenorhabditis elegans.
Development 2010 137(10) 1657-67 
[ PubMed ID = 20392746 ] [ RRC reference ]