分離済み変異体

tm651

Allele Nametm651
BalanceRequest Available
OutCrossNot Accepted
Sequence NameR13F6.4
Gene Nameten-1
Worm BaseAllele Name tm651
Gene Name ten-1
Sequence R13F6.4
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" lethal or sterile. Dr. J. Kaplan: wild type movement, nonEgl, nonRic.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 3657/3658-4550/4551(890 bp deletion)
ChromosomeIII
Putative gene structurejoin(31521..31880, 32025..32079, 3443..3541, 3605..3786, 3878..4049, 4101..5371, 5424..6668, 6716..7231, 7284..8383, 8447..8803, 9050..10970, 11019..11670, 11752..12363)
Map position-0.94
Balancer
Map position of balancer
Sequence of primersExtFwd:ACGTCTGGAGGAGCACCGAA,ExtRev:CACATTCGCCTTTTCCGGAA,IntFwd:CCCAACGTATTCGGATGCAT,IntRev:CACTGATTTGGACATCCATC
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Topf U, Drabikowski K.
Ancient Function of Teneurins in Tissue Organization and Neuronal Guidance in the Nematode Caenorhabditis elegans.
Front Neurosci 2019 13 205 
[ PubMed ID = 30906249 ] [ RRC reference ]

Topf U, Chiquet-Ehrismann R.
Genetic interaction between Caenorhabditis elegans teneurin ten-1 and prolyl 4-hydroxylase phy-1 and their function in collagen IV-mediated basement membrane integrity during late elongation of the embryo.
Mol Biol Cell 2011 22(18) 3331-43 
[ PubMed ID = 21795395 ] [ RRC reference ]

Mörck C, Vivekanand V, Jafari G, Pilon M.
C. elegans ten-1 is synthetic lethal with mutations in cytoskeleton regulators, and enhances many axon guidance defective mutants.
BMC Dev Biol 2010 10 55 
[ PubMed ID = 20497576 ] [ RRC reference ]

Trzebiatowska A, Topf U, Sauder U, Drabikowski K, Chiquet-Ehrismann R.
Caenorhabditis elegans teneurin, ten-1, is required for gonadal and pharyngeal basement membrane integrity and acts redundantly with integrin ina-1 and dystroglycan dgn-1.
Mol Biol Cell 2008 19(9) 3898-908 
[ PubMed ID = 18632986 ] [ RRC reference ]