| Allele Name | tm651 |
| Balance | Completed |
| OutCross | Not Accepted |
| Sequence Name | R13F6.4 |
| Gene Name | ten-1 |
| Worm Base | Allele Name |
tm651
(x1) |
| Gene Name |
ten-1
|
| Sequence |
R13F6.4
|
Phenotype
Information from the receiver is posted in the form
of a "researcher : phenotype"
| lethal or sterile. Dr. J. Kaplan: wild type movement, nonEgl, nonRic. |
Mutation site
Please see gene structure to locate the deletion in
relation to exon(s)
| 3657/3658-4550/4551(890 bp deletion) |
| Chromosome | III |
| Putative gene structure | join(31521..31880, 32025..32079, 3443..3541, 3605..3786, 3878..4049, 4101..5371, 5424..6668, 6716..7231, 7284..8383, 8447..8803, 9050..10970, 11019..11670, 11752..12363) |
| Map position | -0.94 |
| Balancer | qC1[nIs281] |
| Map position of balancer | |
| Sequence of primers | ExtFwd:ACGTCTGGAGGAGCACCGAA,ExtRev:CACATTCGCCTTTTCCGGAA,IntFwd:CCCAACGTATTCGGATGCAT,IntRev:CACTGATTTGGACATCCATC |
| Distributed lab | |
| Depositor | Dr. S. Mitani/NBRP |
| References |
Please submit your publication
Topf U, Drabikowski K. Ancient Function of Teneurins in Tissue Organization and Neuronal Guidance in the Nematode Caenorhabditis elegans. Front Neurosci 2019 13 205
[ PubMed ID = 30906249 ]
[ RRC reference ]
|
Topf U, Chiquet-Ehrismann R. Genetic interaction between Caenorhabditis elegans teneurin ten-1 and prolyl 4-hydroxylase phy-1 and their function in collagen IV-mediated basement membrane integrity during late elongation of the embryo. Mol Biol Cell 2011 22(18) 3331-43
[ PubMed ID = 21795395 ]
[ RRC reference ]
|
Mörck C, Vivekanand V, Jafari G, Pilon M. C. elegans ten-1 is synthetic lethal with mutations in cytoskeleton regulators, and enhances many axon guidance defective mutants. BMC Dev Biol 2010 10 55
[ PubMed ID = 20497576 ]
[ RRC reference ]
|
Trzebiatowska A, Topf U, Sauder U, Drabikowski K, Chiquet-Ehrismann R. Caenorhabditis elegans teneurin, ten-1, is required for gonadal and pharyngeal basement membrane integrity and acts redundantly with integrin ina-1 and dystroglycan dgn-1. Mol Biol Cell 2008 19(9) 3898-908
[ PubMed ID = 18632986 ]
[ RRC reference ]
|
|