| Allele Name | tm6502 |
| Balance | Not Required |
| OutCross | Not Accepted |
| Sequence Name | K04C1.1 |
| Gene Name | srg-37 |
| Worm Base | Allele Name |
tm6502
|
| Gene Name |
srg-37
|
| Sequence |
K04C1.1
|
Phenotype
Information from the receiver is posted in the form
of a "researcher : phenotype"
| homozygous viable. |
Mutation site
Please see gene structure to locate the deletion in
relation to exon(s)
| 4143/4144-4928/4929 (785 bp deletion) |
| Chromosome | X |
| Putative gene structure | complement(join(3737..3841, 3895..4129, 4178..4284, 4337..4413, 4465..4711, 4926..5078)) |
| Map position | 15.23 |
| Balancer | |
| Map position of balancer | |
| Sequence of primers | ExtFwd:GCCGTGCTCAGCAAATACCA,ExtRev:GGCCGAATACAAAAACCATG,IntFwd:TGCCGCACACCCCTAATACA,IntRev:CCATGCCATCTTCAAGTCCT |
| Distributed lab | |
| Depositor | Dr. S. Mitani/NBRP |
| References |
Please submit your publication
Peng JY, Liu X, Zeng XT, Hao Y, Zhang JH, Li Q, Tong XJ. Early pheromone perception remodels neurodevelopment and accelerates neurodegeneration in adult C. elegans. Cell Rep 2023 42(6) 112598
[ PubMed ID = 37289584 ]
[ RRC reference ]
|
Li N, Hua B, Chen Q, Teng F, Ruan M, Zhu M, Zhang L, Huo Y, Liu H, Zhuang M, Shen H, Zhu H. A sphingolipid-mTORC1 nutrient-sensing pathway regulates animal development by an intestinal peroxisome relocation-based gut-brain crosstalk. Cell Rep 2022 40(4) 111140
[ PubMed ID = 35905721 ]
[ RRC reference ]
|
|