| Allele Name | tm6452 |
| Balance | Not Required |
| OutCross | Not Accepted |
| Sequence Name | K08H10.1 |
| Gene Name | lea-1 |
| Worm Base | Allele Name |
tm6452
|
| Gene Name |
lea-1
|
| Sequence |
K08H10.1
|
Phenotype
Information from the receiver is posted in the form
of a "researcher : phenotype"
| homozygous viable. |
Mutation site
Please see gene structure to locate the deletion in
relation to exon(s)
| 37243/37244-AAAAAAAAAAAAAAAAAAAA-37699/37700 (456 bp deletion + 20 bp insertion) |
| Chromosome | V |
| Putative gene structure | join(24915..24953, 26257..26463, 33537..33650, 33695..34477, 34526..35092, 35188..35526, 35669..36040, 36551..37891, 37946..38011, 38527..38703, Z73975.1:221..301, Z73975.1:1373..1480) |
| Map position | 2.23 |
| Balancer | |
| Map position of balancer | |
| Sequence of primers | IntFwd:GCATGTATCTTCAGTGTCCT,ExtRev:GTATCATGGGCAGCTTCCGA,IntRev:ACATGTGCTCCGTGCATATA,ExtFwd:GTCCTCGATTCCCATTGATC |
| Distributed lab | |
| Depositor | Dr. S. Mitani/NBRP |
| References |
Please submit your publication
Mazzetto M, Gonzalez LE, Sanchez N, Reinke V. Characterization of the distribution and dynamics of chromatin states in the C. elegans germline reveals substantial H3K4me3 remodeling during oogenesis. Genome Res 2024 34(1) 57-69
[ PubMed ID = 38164610 ]
[ RRC reference ]
|
Dejima K, Imae R, Suehiro Y, Yoshida K, Mitani S. An endomembrane zinc transporter negatively regulates systemic RNAi in Caenorhabditis elegans. iScience 2023 26(6) 106930
[ PubMed ID = 37305693 ]
[ RRC reference ]
|
Hibshman JD, Goldstein B. LEA motifs promote desiccation tolerance in vivo. BMC Biol 2021 19(1) 263
[ PubMed ID = 34903234 ]
[ RRC reference ]
|
|