| Allele Name | tm642 |
| Balance | Not Required |
| OutCross | Not Accepted |
| Sequence Name | M60.5 |
| Gene Name | kqt-2 |
| Worm Base | Allele Name |
tm642
|
| Gene Name |
kqt-2
|
| Sequence |
M60.5
|
Phenotype
Information from the receiver is posted in the form
of a "researcher : phenotype"
| homozygous viable |
|
Mutation site
Please see gene structure to locate the deletion in
relation to exon(s)
| 13097/13098-13968/13969 (871 bp deletion) |
| Chromosome | X |
| Putative gene structure | complement(join(11804..11972, 12026..12291, 12459..12656, 12804..12954, 13004..13232, 13519..13689, 13735..13868, 13933..14006, 14084..14214, 14260..14436, 14483..14562, 14611..14825)) |
| Map position | -0.27 |
| Balancer | |
| Map position of balancer | |
| Sequence of primers | ExtFwd:AACAACTGCTAGCGTGTCTG,IntRev:CCAACACCCCAATGTTTGTT,IntFwd:TGGCAGACTGGAACGTCGAT,ExtRev:ACGTTGCGTTATCAGTTGAC |
| Distributed lab | |
| Depositor | Dr. S. Mitani/NBRP |
| References |
Please submit your publication
Wang L, Graziano B, Encalada N, Fernandez-Abascal J, Kaplan DH, Bianchi L.
Glial regulators of ions and solutes required for specific chemosensory functions in Caenorhabditis elegans.
iScience 2022 25(12) 105684
[ PubMed ID = 36567707 ]
[ RRC reference ]
|
Okahata M, Wei AD, Ohta A, Kuhara A.
Cold acclimation via the KQT-2 potassium channel is modulated by oxygen in Caenorhabditis elegans.
Sci Adv 2019 5(2) eaav3631
[ PubMed ID = 30775442 ]
[ RRC reference ]
|
Nehrke K, Denton J, Mowrey W.
Intestinal Ca2+ wave dynamics in freely moving C. elegans coordinate execution of a rhythmic motor program.
Am J Physiol Cell Physiol 2008 294(1) C333-44
[ PubMed ID = 17942636 ]
[ RRC reference ]
|
|
Copyright © 2009 NBRP-C. elegans. All rights reserved.