分離済み変異体

tm6403

Allele Nametm6403
BalanceNot Required
OutCrossNot Accepted
Sequence NameK10D3.1
Gene Nameglr-3
Worm BaseAllele Name tm6403
Gene Name glr-3
Sequence K10D3.1
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 3398/3399-3887/3888 (489 bp deletion)
ChromosomeI
Putative gene structurejoin(3060..3126, 3173..3414, 3546..3843, 3888..4000, 4043..4198, 4243..4465, 4679..4872, 4919..5035, 5083..5187, 5233..5351, 5395..5512, 5559..5777, 5823..5921, 6311..6523, 6570..6797)
Map position1.77
Balancer
Map position of balancer
Sequence of primersExtFwd:CACTCTCCTCATCTGCGATA,IntFwd:TAATGACGCTTCGCTTGCTT,ExtRev:CCCCTCTCTGTAATTCTCCA,IntRev:ATTAGCTTTCTGCTTGGCCT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Ohnishi K, Sokabe T, Miura T, Tominaga M, Ohta A, Kuhara A.
G protein-coupled receptor-based thermosensation determines temperature acclimatization of Caenorhabditis elegans.
Nat Commun 2024 15(1) 1660 
[ PubMed ID = 38396085 ] [ RRC reference ]

Lin C, Shan Y, Wang Z, Peng H, Li R, Wang P, He J, Shen W, Wu Z, Guo M.
Molecular and circuit mechanisms underlying avoidance of rapid cooling stimuli in C. elegans.
Nat Commun 2024 15(1) 297 
[ PubMed ID = 38182628 ] [ RRC reference ]

Liu H, Wu JJ, Li R, Wang PZ, Huang JH, Xu Y, Zhao JL, Wu PP, Li SJ, Wu ZX.
Disexcitation in the ASH/RIM/ADL negative feedback circuit fine-tunes hyperosmotic sensation and avoidance in Caenorhabditis elegans.
Front Mol Neurosci 2023 16 1101628 
[ PubMed ID = 37008778 ] [ RRC reference ]

Wang M, Witvliet D, Wu M, Kang L, Shao Z.
Temperature regulates synaptic subcellular specificity mediated by inhibitory glutamate signaling.
PLoS Genet 2021 17(1) e1009295 
[ PubMed ID = 33428618 ] [ RRC reference ]

Ohnishi K, Saito S, Miura T, Ohta A, Tominaga M, Sokabe T, Kuhara A.
OSM-9 and OCR-2 TRPV channels are accessorial warm receptors in Caenorhabditis elegans temperature acclimatisation.
Sci Rep 2020 10(1) 18566 
[ PubMed ID = 33122746 ] [ RRC reference ]

Wen X, Chen YH, Li R, Ge MH, Yin SW, Wu JJ, Huang JH, Liu H, Wang PZ, Gross E, Wu ZX.
Signal Decoding for Glutamate Modulating Egg Laying Oppositely in Caenorhabditiselegans under Varied Environmental Conditions.
iScience 2020 23(10) 101588 
[ PubMed ID = 33089099 ] [ RRC reference ]

Gong J, Liu J, Ronan EA, He F, Cai W, Fatima M, Zhang W, Lee H, Li Z, Kim GH, Pipe KP, Duan B, Liu J, Xu XZS.
A Cold-Sensing Receptor Encoded by a Glutamate Receptor Gene.
Cell 2019 178(6) 1375-1386.e11 
[ PubMed ID = 31474366 ] [ RRC reference ]