| Allele Name | tm635 |
| Balance | Completed |
| OutCross | Not Accepted |
| Sequence Name | R07E4.6 |
| Gene Name | kin-2 |
| Worm Base | Allele Name |
tm635
(x1) |
| Gene Name |
kin-2
|
| Sequence |
R07E4.6
|
Phenotype
Information from the receiver is posted in the form
of a "researcher : phenotype"
| lethal or sterile |
|
Mutation site
Please see gene structure to locate the deletion in
relation to exon(s)
| 28155/28156-28765/28766 (610 bp deletion ) |
| Chromosome | X |
| Putative gene structure | complement(join(27370..27542, 27906..28109, 28176..28290, 28335..28448, 28495..28608, 28673..28879, 33267..33349, 33409..33529)) |
| Map position | -3.98 |
| Balancer | ,tmC30[tmIs1247] |
| Map position of balancer | |
| Sequence of primers | ExtRev:GAGTTGAACATGTACCGGGT,IntRev:GTGAGCGAGTGGGTGTATTT,IntFwd:CCGATTAGGTCATCAGTTTG,ExtFwd:TGAGGAAGATGCGGGGCAAA |
| Distributed lab | |
| Depositor | Dr. S. Mitani/NBRP |
| References |
Please submit your publication
Lee JH, Han JS, Kong J, Ji Y, Lv X, Lee J, Li P, Kim JB.
Protein Kinase A Subunit Balance Regulates Lipid Metabolism in Caenorhabditis elegans and Mammalian Adipocytes.
J Biol Chem 2016 291(39) 20315-28
[ PubMed ID = 27496951 ]
[ RRC reference ]
|
Song BM, Avery L.
Serotonin activates overall feeding by activating two separate neural pathways in Caenorhabditis elegans.
J Neurosci 2012 32(6) 1920-31
[ PubMed ID = 22323705 ]
[ RRC reference ]
|
|
Copyright © 2009 NBRP-C. elegans. All rights reserved.