Allele Name | tm629 |
Allele Type | 通常株 |
Sequence Name | F46C3.1 |
Gene Name | pek-1 |
Worm Base | Allele Name |
tm629
|
Gene Name |
pek-1
|
Sequence |
F46C3.1
|
Phenotype
Information from the receiver is posted in the form of a "researcher : phenotype"
| homozygous viable. Dr. N. Tavernarakis: normal development, normal locomotion, slightly shorter, less progeny at 25C. |
Mutation site
Please see gene structure to locate the deletion in relation to exon(s)
| 1862/1863-TT-3335/3336 (1473 bp deletion + 2 bp insertion) |
Chromosome | I |
Putative gene structure | join(complement(3682..3795), complement(3460..3624), complement(2750..3286), complement(2424..2700), complement(2206..2376), complement(1899..2155), complement(1748..1849), complement(1130..1425), complement(709..1079), complement(385..659), complement(105..304), complement(Z68104.1:26738..27119), complement(Z68104.1:26574..26660)) |
Map position | -7.97 |
Balancer | |
Map position of balancer | |
Sequence of primers | IntFwd:GAGGTTGAGTATGAGTCTCA,ExtFwd:TACCAGTCGTTGAACGGGCT,IntRev:GGCCAACAGTACATCGATGA,ExtRev:CTTGGTACCATTCAACGCTG |
Distributed lab | |
Depositor | Dr. S. Mitani/NBRP |
References |
Please submit your publication
Guan L, Zhan Z, Yang Y, Miao Y, Huang X, Ding M. Alleviating chronic ER stress by p38-Ire1-Xbp1 pathway and insulin-associated autophagy in C. elegans neurons. PLoS Genet 2020 16(9) e1008704
[ PubMed ID = 32986702 ]
[ RRC reference ]
|
Kulalert W, Kim DH. The unfolded protein response in a pair of sensory neurons promotes entry of C. elegans into dauer diapause. Curr Biol 2013 23(24) 2540-5
[ PubMed ID = 24316205 ]
[ RRC reference ]
|
Richardson CE, Kinkel S, Kim DH. Physiological IRE-1-XBP-1 and PEK-1 signaling in Caenorhabditis elegans larval development and immunity. PLoS Genet 2011 7(11) e1002391
[ PubMed ID = 22125500 ]
[ RRC reference ]
|
Nukazuka A, Fujisawa H, Inada T, Oda Y, Takagi S. Semaphorin controls epidermal morphogenesis by stimulating mRNA translation via eIF2alpha in Caenorhabditis elegans. Genes Dev 2008 22(8) 1025-36
[ PubMed ID = 18413715 ]
[ RRC reference ]
|
|