分離済み変異体

tm629

Allele Nametm629
BalanceNot Required
OutCrossNot Accepted
Sequence NameF46C3.1
Gene Namepek-1
Worm BaseAllele Name tm629
Gene Name pek-1
Sequence F46C3.1
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable. Dr. N. Tavernarakis: normal development, normal locomotion, slightly shorter, less progeny at 25C.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 1862/1863-TT-3335/3336 (1473 bp deletion + 2 bp insertion)
ChromosomeI
Putative gene structurejoin(complement(3682..3795), complement(3460..3624), complement(2750..3286), complement(2424..2700), complement(2206..2376), complement(1899..2155), complement(1748..1849), complement(1130..1425), complement(709..1079), complement(385..659), complement(105..304), complement(Z68104.1:26738..27119), complement(Z68104.1:26574..26660))
Map position-7.97
Balancer
Map position of balancer
Sequence of primersIntFwd:GAGGTTGAGTATGAGTCTCA,ExtFwd:TACCAGTCGTTGAACGGGCT,IntRev:GGCCAACAGTACATCGATGA,ExtRev:CTTGGTACCATTCAACGCTG
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Guan L, Zhan Z, Yang Y, Miao Y, Huang X, Ding M.
Alleviating chronic ER stress by p38-Ire1-Xbp1 pathway and insulin-associated autophagy in C. elegans neurons.
PLoS Genet 2020 16(9) e1008704 
[ PubMed ID = 32986702 ] [ RRC reference ]

Kulalert W, Kim DH.
The unfolded protein response in a pair of sensory neurons promotes entry of C. elegans into dauer diapause.
Curr Biol 2013 23(24) 2540-5 
[ PubMed ID = 24316205 ] [ RRC reference ]

Richardson CE, Kinkel S, Kim DH.
Physiological IRE-1-XBP-1 and PEK-1 signaling in Caenorhabditis elegans larval development and immunity.
PLoS Genet 2011 7(11) e1002391 
[ PubMed ID = 22125500 ] [ RRC reference ]

Nukazuka A, Fujisawa H, Inada T, Oda Y, Takagi S.
Semaphorin controls epidermal morphogenesis by stimulating mRNA translation via eIF2alpha in Caenorhabditis elegans.
Genes Dev 2008 22(8) 1025-36 
[ PubMed ID = 18413715 ] [ RRC reference ]