| Allele Name | tm6233 |
| Balance | Completed |
| OutCross | Not Accepted |
| Sequence Name | F10E7.8 |
| Gene Name | farl-11 |
| Worm Base | Allele Name |
tm6233
(x1) |
| Gene Name |
farl-11
|
| Sequence |
F10E7.8
|
Phenotype
Information from the receiver is posted in the form
of a "researcher : phenotype"
| Let or Ste. |
Mutation site
Please see gene structure to locate the deletion in
relation to exon(s)
| 3478/3479-4060/4061 (582 bp deletion) |
| Chromosome | II |
| Putative gene structure | complement(join(900..1126, 1176..1637, 1685..1769, 1985..3460, 3510..3689, 3736..3885, 4119..4291, 4518..4554)) |
| Map position | 0.49 |
| Balancer | mIn1 [e128 mIs14] |
| Map position of balancer | |
| Sequence of primers | IntRev:CGTTAAAGCGGAGTGTCGTA,ExtRev:AGGCGCAAAATAACTACGGT,IntFwd:CGGTTTTCGTTTCTGGGATA,ExtFwd:CATAACCTTCACCAGAGCAC |
| Distributed lab | |
| Depositor | Dr. S. Mitani/NBRP |
| References |
Please submit your publication
Martin SCT, Qadota H, Oberhauser AF, Hardin J, Benian GM. FARL-11 (STRIP1/2) is required for sarcomere and sarcoplasmic reticulum organization in C. elegans. Mol Biol Cell 2023 34(9) ar86
[ PubMed ID = 37314837 ]
[ RRC reference ]
|
Maheshwari R, Pushpa K, Subramaniam K. A role for post-transcriptional control of endoplasmic reticulum dynamics and function in C. elegans germline stem cell maintenance. Development 2016 143(17) 3097-108
[ PubMed ID = 27510976 ]
[ RRC reference ]
|
|