Allele Name | tm6139 |
Allele Type | 通常株 |
Sequence Name | T04D1.4 |
Gene Name | chd-7 |
Worm Base | Allele Name |
tm6139
|
Gene Name |
chd-7
|
Sequence |
T04D1.4
|
Phenotype
Information from the receiver is posted in the form of a "researcher : phenotype"
| Let or Ste. |
Mutation site
Please see gene structure to locate the deletion in relation to exon(s)
| 25600/25601-26194/26195 (594 bp deletion) |
Chromosome | I |
Putative gene structure | complement(join(17151..17432, 17508..17773, 17951..19613, 19791..21724, 22308..23422, 24024..26092, 26140..26805, 27431..27943, 28256..28621)) |
Map position | -0.93 |
Balancer | |
Map position of balancer | |
Sequence of primers | ExtRev:GCTACTCGATAGAATACTCG,IntRev:CGGGTTCCCGTAATATGTGT,ExtFwd:GCTCCCATGTCACCTCTTCG,IntFwd:GTCCATCGTCTTCAGTAATG |
Distributed lab | |
Depositor | Dr. S. Mitani |
References |
Please submit your publication
Jofré DM, Hoffman DK, Cervino AS, Hahn GM, Grundy M, Yun S, Amrit FRG, Stolz DB, Godoy LF, Salvatore E, Rossi FA, Ghazi A, Cirio MC, Yanowitz JL, Hochbaum D. The CHARGE syndrome ortholog CHD-7 regulates TGF-β pathways in Caenorhabditis elegans. Proc Natl Acad Sci U S A 2022 119(15) e2109508119
[ PubMed ID = 35394881 ]
[ RRC reference ]
|
Wong WR, Brugman KI, Maher S, Oh JY, Howe K, Kato M, Sternberg PW. Autism-associated missense genetic variants impact locomotion and neurodevelopment in Caenorhabditis elegans. Hum Mol Genet 2019 28(13) 2271-2281
[ PubMed ID = 31220273 ]
[ RRC reference ]
|
|