Allele Name | tm6109 |
Allele Type | 通常株 |
Sequence Name | Y8A9A.6 |
Gene Name | ins-32 |
Worm Base | Allele Name |
tm6109
|
Gene Name |
ins-32
|
Sequence |
Y8A9A.6
|
Phenotype
Information from the receiver is posted in the form of a "researcher : phenotype"
| homozygous viable. |
Mutation site
Please see gene structure to locate the deletion in relation to exon(s)
| 15033/15034-T-15411/15412 (378 bp deletion + 1 bp insertion) |
Chromosome | II |
Putative gene structure | complement(join(14870..14964, 15011..15212)) |
Map position | -6.21 |
Balancer | |
Map position of balancer | |
Sequence of primers | IntRev:GTAAATGATCGTGGCAGGAC,ExtRev:GTCAGCACGTTCCCCTCTCT,IntFwd:AGGTTGCAGTTGGACAGCAC,ExtFwd:GTAAGTGTTCAGGGGATTAG |
Distributed lab | |
Depositor | Dr. S. Mitani/NBRP |
References |
Please submit your publication
Levi-Ferber M, Shalash R, Le-Thomas A, Salzberg Y, Shurgi M, Benichou JI, Ashkenazi A, Henis-Korenblit S. Neuronal regulated ire-1-dependent mRNA decay controls germline differentiation in Caenorhabditis elegans. Elife 2021 10
[ PubMed ID = 34477553 ]
[ RRC reference ]
|
Yeon J, Takeishi A, Sengupta P. Chronic vs acute manipulations reveal degeneracy in a thermosensory neuron network. MicroPubl Biol 2021 2021
[ PubMed ID = 33474527 ]
[ RRC reference ]
|
Ryu L, Cheon Y, Huh YH, Pyo S, Chinta S, Choi H, Butcher RA, Kim K. Feeding state regulates pheromone-mediated avoidance behavior via the insulin signaling pathway in Caenorhabditis elegans. EMBO J 2018 37(15)
[ PubMed ID = 29925517 ]
[ RRC reference ]
|
|