| Allele Name | tm609 |
| Balance | Not Required |
| OutCross | Not Accepted |
| Sequence Name | F27E5.1 |
| Gene Name | asah-2 |
| Worm Base | Allele Name |
tm609
|
| Gene Name |
asah-2
|
| Sequence |
F27E5.1
|
Phenotype
Information from the receiver is posted in the form
of a "researcher : phenotype"
| homozygous viable |
|
Mutation site
Please see gene structure to locate the deletion in
relation to exon(s)
| 18929/18930-19644/19645 (715 bp deletion) |
| Chromosome | II |
| Putative gene structure | join(18200..18244, 18368..18469, 18583..18687, 18733..19132, 19186..19343, 19442..19624, 19690..19782, 19828..19947) |
| Map position | 1.98 |
| Balancer | |
| Map position of balancer | |
| Sequence of primers | IntRev:GACAGTGTGGACAGTAGTCT,IntFwd:ACAGATGCTCCAGGAGGCAA,ExtRev:AAGTAGCCCTTGGTGACAGA,ExtFwd:CATCCGACAACTCCATCACA |
| Distributed lab | |
| Depositor | Dr. S. Mitani/NBRP |
| References |
Please submit your publication
Peters L, Drechsler M, Herrera MA, Liu J, Pees B, Jarstorff J, Czerwinski A, Lubbock F, Angelidou G, Salzer L, Moors KA, Paczia N, Shi YM, Schulenburg H, Kaleta C, Witting M, Liebeke M, Campopiano DJ, Bode HB, Dierking K.
Polyketide synthase-derived sphingolipids mediate microbiota protection against a bacterial pathogen in C. elegans.
Nat Commun 2025 16(1) 5151
[ PubMed ID = 40461452 ]
[ RRC reference ]
|
|
Copyright © 2009 NBRP-C. elegans. All rights reserved.