| Allele Name | tm6082 |
| Balance | Not Required |
| OutCross | Not Accepted |
| Sequence Name | C43H8.2 |
| Gene Name | mafr-1 |
| Worm Base | Allele Name |
tm6082
|
| Gene Name |
mafr-1
|
| Sequence |
C43H8.2
|
Phenotype
Information from the receiver is posted in the form
of a "researcher : phenotype"
| homozygous viable. |
Mutation site
Please see gene structure to locate the deletion in
relation to exon(s)
| 4494/4495-4708/4709 (214 bp deletion) |
| Chromosome | I |
| Putative gene structure | join(3902..3984, 4035..4374, 4424..4545, 4597..4789) |
| Map position | 5.06 |
| Balancer | |
| Map position of balancer | |
| Sequence of primers | ExtFwd:TACACAGAAGTTGCCGACAG,IntFwd:TACGTAGGATTTTTCCGCAC,ExtRev:GCCGGCAAGACTAATACTAT,IntRev:ATGGACGTGTCGGCTTGTTT |
| Distributed lab | |
| Depositor | Dr. S. Mitani/NBRP |
| References |
Please submit your publication
Mazzetto M, Gonzalez LE, Sanchez N, Reinke V. Characterization of the distribution and dynamics of chromatin states in the C. elegans germline reveals substantial H3K4me3 remodeling during oogenesis. Genome Res 2024 34(1) 57-69
[ PubMed ID = 38164610 ]
[ RRC reference ]
|
Pradhan A, Hammerquist AM, Khanna A, Curran SP. The C-Box Region of MAF1 Regulates Transcriptional Activity and Protein Stability. J Mol Biol 2017 429(2) 192-207
[ PubMed ID = 27986570 ]
[ RRC reference ]
|
Cai Y, Wei YH. Stress resistance and lifespan are increased in C. elegans but decreased in S. cerevisiae by mafr-1/maf1 deletion. Oncotarget 2016 7(10) 10812-26
[ PubMed ID = 26934328 ]
[ RRC reference ]
|
|