| Allele Name | tm6048 |
| Balance | Not Required |
| OutCross | Not Accepted |
| Sequence Name | ZC155.3 |
| Gene Name | morc-1 |
| Worm Base | Allele Name |
tm6048
|
| Gene Name |
morc-1
|
| Sequence |
ZC155.3
|
Phenotype
Information from the receiver is posted in the form
of a "researcher : phenotype"
| homozygous viable. |
|
Mutation site
Please see gene structure to locate the deletion in
relation to exon(s)
| 7929/7930-8338/8339 (409 bp deletion) |
| Chromosome | III |
| Putative gene structure | complement(join(5616..5684, 5734..5973, 6023..6714, 6763..7401, 7446..7587, 7663..8249, 8301..8389, 8445..8524)) |
| Map position | -2.01 |
| Balancer | |
| Map position of balancer | |
| Sequence of primers | ExtFwd:ACAGCTTCCAAATCCCACAC,ExtRev:ATGCTGCATTGGCCTAAAGT,IntFwd:GTCCACATCACCTGATCCCT,IntRev:TTGTCCTCTGTTCGGGCCTC |
| Distributed lab | |
| Depositor | Dr. S. Mitani/NBRP |
| References |
Please submit your publication
Mazzetto M, Gonzalez LE, Sanchez N, Reinke V.
Characterization of the distribution and dynamics of chromatin states in the C. elegans germline reveals substantial H3K4me3 remodeling during oogenesis.
Genome Res 2024 34(1) 57-69
[ PubMed ID = 38164610 ]
[ RRC reference ]
|
Spracklin G, Fields B, Wan G, Becker D, Wallig A, Shukla A, Kennedy S.
The RNAi Inheritance Machinery of Caenorhabditis elegans.
Genetics 2017 206(3) 1403-1416
[ PubMed ID = 28533440 ]
[ RRC reference ]
|
Weiser NE, Yang DX, Feng S, Kalinava N, Brown KC, Khanikar J, Freeberg MA, Snyder MJ, Csankovszki G, Chan RC, Gu SG, Montgomery TA, Jacobsen SE, Kim JK.
MORC-1 Integrates Nuclear RNAi and Transgenerational Chromatin Architecture to Promote Germline Immortality.
Dev Cell 2017 41(4) 408-423.e7
[ PubMed ID = 28535375 ]
[ RRC reference ]
|
|
Copyright © 2009 NBRP-C. elegans. All rights reserved.