分離済み変異体

tm604

Allele Nametm604
BalanceRequest Available
OutCrossNot Accepted
Sequence NameT05G5.2
Gene Namehlh-4
Worm BaseAllele Name tm604
Gene Name hlh-4
Sequence T05G5.2
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" lethal or sterile.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 9219/9220-10003/10004 (784 bp deletion)
ChromosomeIII
Putative gene structurecomplement(join(8982..9536, 10270..10332))
Map position0.93
Balancer
Map position of balancer
Sequence of primersIntRev:TAAAATATCCGCCATGAGGG,ExtRev:CTTAAGCCGTACACTGTGCA,ExtFwd:TCCCGCCAGTGCTAAGGTTT,IntFwd:AACGATTGCTCTATGCACTG
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Szczepańska A, Olek K, Kołodziejska K, Yu J, Ibrahim AT, Adamkiewicz L, Schroeder FC, Pokrzywa W, Turek M.
Pheromone-based communication influences the production of somatic extracellular vesicles in C. elegans.
Nat Commun 2024 15(1) 2715 
[ PubMed ID = 38548742 ] [ RRC reference ]

Brinzer RA, Winter AD, Page AP.
The relationship between intraflagellar transport and upstream protein trafficking pathways and macrocyclic lactone resistance in Caenorhabditis elegans.
G3 (Bethesda) 2024 14(3)  
[ PubMed ID = 38227795 ] [ RRC reference ]

Ow MC, Nishiguchi MA, Dar AR, Butcher RA, Hall SE.
RNAi-dependent expression of sperm genes in ADL chemosensory neurons is required for olfactory responses in Caenorhabditis elegans.
Front Mol Biosci 2024 11 1396587 
[ PubMed ID = 39055986 ] [ RRC reference ]

Masoudi N, Tavazoie S, Glenwinkel L, Ryu L, Kim K, Hobert O.
Unconventional function of an Achaete-Scute homolog as a terminal selector of nociceptive neuron identity.
PLoS Biol 2018 16(4) e2004979 
[ PubMed ID = 29672507 ] [ RRC reference ]

Luo S, Horvitz HR.
The CDK8 Complex and Proneural Proteins Together Drive Neurogenesis from a Mesodermal Lineage.
Curr Biol 2017 27(5) 661-672 
[ PubMed ID = 28238659 ] [ RRC reference ]

Dimitriadi M, Sleigh JN, Walker A, Chang HC, Sen A, Kalloo G, Harris J, Barsby T, Walsh MB, Satterlee JS, Li C, Van Vactor D, Artavanis-Tsakonas S, Hart AC.
Conserved genes act as modifiers of invertebrate SMN loss of function defects.
PLoS Genet 2010 6(10) e1001172 
[ PubMed ID = 21124729 ] [ RRC reference ]