分離済み変異体

tm6026

Allele Nametm6026
BalanceNot Required
OutCrossNot Accepted
Sequence NameK02B2.3
Gene Namemcu-1
Worm BaseAllele Name tm6026
Gene Name mcu-1
Sequence K02B2.3
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 2082/2083-2409/2410 (327 bp deletion)
ChromosomeIV
Putative gene structurecomplement(join(1390..1593, 1742..1860, 1910..2136, 2204..2336, 2382..2610, 2844..2933))
Map position2.72
Balancer
Map position of balancer
Sequence of primersIntRev:CGTCTTTTCAGGGTCACACA,ExtRev:TCCGTACAACACCACCACCA,IntFwd:CGTTCCCGAGCAGATGGATA,ExtFwd:TAGTGTAGACACGTTCCCGA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Ryan KC, Ashkavand Z, Sarasija S, Laboy JT, Samarakoon R, Norman KR.
Increased mitochondrial calcium uptake and concomitant mitochondrial activity by presenilin loss promotes mTORC1 signaling to drive neurodegeneration.
Aging Cell 2021 20(10) e13472 
[ PubMed ID = 34499406 ] [ RRC reference ]

Ashkavand Z, Sarasija S, Ryan KC, Laboy JT, Norman KR.
Corrupted ER-mitochondrial calcium homeostasis promotes the collapse of proteostasis.
Aging Cell 2020 19(1) e13065 
[ PubMed ID = 31714672 ] [ RRC reference ]

Zhao T, Hao Y, Kaplan JM.
Axonal Mitochondria Modulate Neuropeptide Secretion Through the Hypoxic Stress Response in Caenorhabditis elegans.
Genetics 2018 210(1) 275-285 
[ PubMed ID = 30049781 ] [ RRC reference ]

Sarasija S, Laboy JT, Ashkavand Z, Bonner J, Tang Y, Norman KR.
Presenilin mutations deregulate mitochondrial Ca2+ homeostasis and metabolic activity causing neurodegeneration in Caenorhabditis elegans.
Elife 2018 7  
[ PubMed ID = 29989545 ] [ RRC reference ]