分離済み変異体

tm598

Allele Nametm598
BalanceNot Required
OutCrossNot Accepted
Sequence NameK08E3.7
Gene Namepdr-1
Worm BaseAllele Name tm598
Gene Name pdr-1
Sequence K08E3.7
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable, Dr. C. Rongo: normal GLR-1::GFP expression. Dr. K. Matsumoto: no Tunicamycin sensitivity. Dr. R. Baumeister: Hum. Mol. Genetics 14, 3407 (2005).
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 31365/31366-32062/32063 (697 bp deletion)
ChromosomeIII
Putative gene structurejoin(30814..30882, 30928..31073, 31164..31600, 32013..32217, 32271..32345, 32392..32533)
Map position23.73
Balancer
Map position of balancer
Sequence of primersIntFwd:TTGTCTCACACGCGACGCGA,ExtRev:GGTACAGTGAATGTGAGCAC,IntRev:CGGTTGCCACGTGGCATTTT,ExtFwd:AATTTGAAGCTCGCTGCGTT
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Uma Naresh N, Kim S, Shpilka T, Yang Q, Du Y, Haynes CM.
Mitochondrial genome recovery by ATFS-1 is essential for development after starvation.
Cell Rep 2022 41(13) 111875 
[ PubMed ID = 36577367 ] [ RRC reference ]

Yang Q, Liu P, Anderson NS, Shpilka T, Du Y, Naresh NU, Li R, Zhu LJ, Luk K, Lavelle J, Zeinert RD, Chien P, Wolfe SA, Haynes CM.
LONP-1 and ATFS-1 sustain deleterious heteroplasmy by promoting mtDNA replication in dysfunctional mitochondria.
Nat Cell Biol 2022 24(2) 181-193 
[ PubMed ID = 35165413 ] [ RRC reference ]

Shpilka T, Du Y, Yang Q, Melber A, Uma Naresh N, Lavelle J, Kim S, Liu P, Weidberg H, Li R, Yu J, Zhu LJ, Strittmatter L, Haynes CM.
UPRmt scales mitochondrial network expansion with protein synthesis via mitochondrial import in Caenorhabditis elegans.
Nat Commun 2021 12(1) 479 
[ PubMed ID = 33473112 ] [ RRC reference ]

Hartman JH, Gonzalez-Hunt C, Hall SM, Ryde IT, Caldwell KA, Caldwell GA, Meyer JN.
Genetic Defects in Mitochondrial Dynamics in Caenorhabditis elegans Impact Ultraviolet C Radiation- and 6-hydroxydopamine-Induced Neurodegeneration.
Int J Mol Sci 2019 20(13)  
[ PubMed ID = 31261893 ] [ RRC reference ]

Martinez BA, Petersen DA, Gaeta AL, Stanley SP, Caldwell GA, Caldwell KA.
Dysregulation of the Mitochondrial Unfolded Protein Response Induces Non-Apoptotic Dopaminergic Neurodegeneration in C. elegans Models of Parkinson's Disease.
J Neurosci 2017 37(46) 11085-11100 
[ PubMed ID = 29030433 ] [ RRC reference ]

Knowlton WM, Hubert T, Wu Z, Chisholm AD, Jin Y.
A Select Subset of Electron Transport Chain Genes Associated with Optic Atrophy Link Mitochondria to Axon Regeneration in Caenorhabditis elegans.
Front Neurosci 2017 11 263 
[ PubMed ID = 28539870 ] [ RRC reference ]

Lin YF, Schulz AM, Pellegrino MW, Lu Y, Shaham S, Haynes CM.
Maintenance and propagation of a deleterious mitochondrial genome by the mitochondrial unfolded protein response.
Nature 2016 533(7603) 416-9 
[ PubMed ID = 27135930 ] [ RRC reference ]

Martinez BA, Kim H, Ray A, Caldwell GA, Caldwell KA.
A bacterial metabolite induces glutathione-tractable proteostatic damage, proteasomal disturbances, and PINK1-dependent autophagy in C. elegans.
Cell Death Dis 2015 6(10) e1908 
[ PubMed ID = 26469957 ] [ RRC reference ]

Schiavi A, Maglioni S, Palikaras K, Shaik A, Strappazzon F, Brinkmann V, Torgovnick A, Castelein N, De Henau S, Braeckman BP, Cecconi F, Tavernarakis N, Ventura N.
Iron-Starvation-Induced Mitophagy Mediates Lifespan Extension upon Mitochondrial Stress in C. elegans.
Curr Biol 2015 25(14) 1810-22 
[ PubMed ID = 26144971 ] [ RRC reference ]

Bornhorst J, Chakraborty S, Meyer S, Lohren H, Brinkhaus SG, Knight AL, Caldwell KA, Caldwell GA, Karst U, Schwerdtle T, Bowman A, Aschner M.
The effects of pdr1, djr1.1 and pink1 loss in manganese-induced toxicity and the role of α-synuclein in C. elegans.
Metallomics 2014 6(3) 476-90 
[ PubMed ID = 24452053 ] [ RRC reference ]

Kramer LB, Shim J, Previtera ML, Isack NR, Lee MC, Firestein BL, Rongo C.
UEV-1 is an ubiquitin-conjugating enzyme variant that regulates glutamate receptor trafficking in C. elegans neurons.
PLoS One 2010 5(12) e14291 
[ PubMed ID = 21179194 ] [ RRC reference ]

Mitani S.
Nematode, an experimental animal in the national BioResource project.
Exp Anim 2009 58(4) 351-6 
[ PubMed ID = 19654432 ] [ RRC reference ]

Springer W, Hoppe T, Schmidt E, Baumeister R.
A Caenorhabditis elegans Parkin mutant with altered solubility couples alpha-synuclein aggregation to proteotoxic stress.
Hum Mol Genet 2005 14(22) 3407-23 
[ PubMed ID = 16204351 ] [ RRC reference ]