分離済み変異体

tm5963

Allele Nametm5963
BalanceNot Required
OutCrossNot Accepted
Sequence NameT26A8.2
Gene Nametmem-231
Worm BaseAllele Name tm5963
Gene Name tmem-231
Sequence T26A8.2
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 8645/8646-8942/8943 (297 bp deletion)
ChromosomeIV
Putative gene structurejoin(8639..8656, 8712..8822, 8867..8945, 8997..9112, 9157..9294, 9346..9557, 9601..9832)
Map position3.79
Balancer
Map position of balancer
Sequence of primersExtFwd:CAACACTTGGCATCTGGGAT,IntRev:AGGGGAACTTGGTGCAGATA,ExtRev:CTAGCGACAGTGAGATGGAC,IntFwd:GATGCGCGGTAATTGAGGCA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Li C, Jensen VL, Park K, Kennedy J, Garcia-Gonzalo FR, Romani M, De Mori R, Bruel AL, Gaillard D, Doray B, Lopez E, Rivière JB, Faivre L, Thauvin-Robinet C, Reiter JF, Blacque OE, Valente EM, Leroux MR.
MKS5 and CEP290 Dependent Assembly Pathway of the Ciliary Transition Zone.
PLoS Biol 2016 14(3) e1002416 
[ PubMed ID = 26982032 ] [ RRC reference ]

Roberson EC, Dowdle WE, Ozanturk A, Garcia-Gonzalo FR, Li C, Halbritter J, Elkhartoufi N, Porath JD, Cope H, Ashley-Koch A, Gregory S, Thomas S, Sayer JA, Saunier S, Otto EA, Katsanis N, Davis EE, Attié-Bitach T, Hildebrandt F, Leroux MR, Reiter JF.
TMEM231, mutated in orofaciodigital and Meckel syndromes, organizes the ciliary transition zone.
J Cell Biol 2015 209(1) 129-42 
[ PubMed ID = 25869670 ] [ RRC reference ]