| Allele Name | tm5906 |
| Balance | Not Required |
| OutCross | Not Accepted |
| Sequence Name | Y73B6BL.18 |
| Gene Name | smg-3 |
| Worm Base | Allele Name |
tm5906
(x1) |
| Gene Name |
smg-3
|
| Sequence |
Y73B6BL.18
|
Phenotype
Information from the receiver is posted in the form
of a "researcher : phenotype"
| homozygous viable |
Mutation site
Please see gene structure to locate the deletion in
relation to exon(s)
| 85425/85426-86759/86760 (1334 bp deletion) |
| Chromosome | IV |
| Putative gene structure | complement(join(79277..79325, 79377..79722, 82002..82080, 82445..82586, 82885..82985, 83044..83185, 83659..84033, 84467..84813, 84865..85737, 85782..85874, 85927..86156, 86206..86417, 86473..86651, 86699..86959)) |
| Map position | 3.17 |
| Balancer | nT1 |
| Map position of balancer | |
| Sequence of primers | ExtFwd:GGAGTATCCTCTTCGTCTAG,IntFwd:GAAGGCAGGTGAAATACGCA,ExtRev:GTTCGCCCCGCGTTTTAATA,IntRev:GACGATTCTCTATCACAGTC |
| Distributed lab | |
| Depositor | Dr. S. Mitani |
| References |
Please submit your publication
Valenzuela-Villatoro M, Gómez-Orte E, Guerrero-Gómez D, Cheng Q, Zheleva A, Mora-Lorca JA, Petrovic D, O Neil NJ, Cerón J, Hatakeyama A, Onami S, Ordóñez-Luque A, Ayuso C, Askjaer P, Filipovic MR, Arnér ESJ, Cabello J, Miranda-Vizuete A. The transsulfuration pathway suppresses the embryonic lethal phenotype of glutathione reductase mutants in Caenorhabditis elegans. G3 (Bethesda) 2025 15(8)
[ PubMed ID = 40333285 ]
[ RRC reference ]
|
|