分離済み変異体

tm588

Allele Nametm588
BalanceNot Required
OutCrossNot Accepted
Sequence NameF59D12.4
Gene Namegpn-1
Worm BaseAllele Name tm588
Gene Name gpn-1
Sequence F59D12.4
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable. Dr. M. Hengartner: no synthetic defects wid sdn-1 mutants.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) [C03H12] 941/942-[C03H12] 1971/1972 (1030 bp deletion)
ChromosomeX
Putative gene structurejoin(36275..36494, Z81459.1:105..286, Z81459.1:336..509, Z81459.1:1743..1905, Z81459.1:1949..2079, Z81459.1:3333..3479, Z81459.1:3601..3790, Z81459.1:3838..3980, Z81459.1:4192..4407)
Map position22.93
Balancer
Map position of balancer
Sequence of primersIntRev:GGAAACCAGATTTTGTCGGT,IntFwd:CGTTCACATGGATCTTGACT,ExtFwd:TCGAAAACCCTGCGAACCGT,ExtRev:GGAATTGGTTGTAGCGCGGA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Gysi S, Rhiner C, Flibotte S, Moerman DG, Hengartner MO.
A network of HSPG core proteins and HS modifying enzymes regulates netrin-dependent guidance of D-type motor neurons in Caenorhabditis elegans.
PLoS One 2013 8(9) e74908 
[ PubMed ID = 24066155 ] [ RRC reference ]

Hudson ML, Kinnunen T, Cinar HN, Chisholm AD.
C. elegans Kallmann syndrome protein KAL-1 interacts with syndecan and glypican to regulate neuronal cell migrations.
Dev Biol 2006 294(2) 352-65 
[ PubMed ID = 16677626 ] [ RRC reference ]