分離済み変異体

tm5775

Allele Nametm5775
BalanceNot Required
OutCrossNot Accepted
Sequence NameZC84.3
Gene Namecls-3
Worm BaseAllele Name tm5775
Gene Name cls-3
Sequence ZC84.3
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 9963/9964-10381/10382 (418 bp deletion)
ChromosomeIII
Putative gene structurecomplement(join(6212..6271, 6321..6440, 6492..7055, 7510..7723, 7811..8097, 8175..8408, 8462..8540, 8594..8639, 9158..9434, 9483..9611, 9660..10043, 10519..10605))
Map position0.31
Balancer
Map position of balancer
Sequence of primersIntRev:GCCATGGAGTCCTCTCGAAT,ExtRev:GCCGGGAAAAACGACACCTC,IntFwd:TAGATCCGGGCCGGTTTGGA,ExtFwd:CGAGAGTCGGTGGAAGTAAT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Hall AN, Morton EA, Walters R, Cuperus JT, Queitsch C.
Phenotypic tolerance for rDNA copy number variation within the natural range of C. elegans.
PLoS Genet 2025 21(7) e1011759 
[ PubMed ID = 40601579 ] [ RRC reference ]

McDiarmid TA, Belmadani M, Liang J, Meili F, Mathews EA, Mullen GP, Hendi A, Wong WR, Rand JB, Mizumoto K, Haas K, Pavlidis P, Rankin CH.
Systematic phenomics analysis of autism-associated genes reveals parallel networks underlying reversible impairments in habituation.
Proc Natl Acad Sci U S A 2020 117(1) 656-667 
[ PubMed ID = 31754030 ] [ RRC reference ]

Yogev S, Cooper R, Fetter R, Horowitz M, Shen K.
Microtubule Organization Determines Axonal Transport Dynamics.
Neuron 2016 92(2) 449-460 
[ PubMed ID = 27764672 ] [ RRC reference ]