分離済み変異体

tm5755

Allele Name

tm5755

Balance

Not Required

OutCross

Not Accepted

Sequence Name

ZK593.6

Gene Name

lgg-2

Worm Base

Allele Name

tm5755

Gene Name

lgg-2

Sequence

ZK593.6

Phenotype

homozygous viable.

Mutation site

24861/24862-25213/25214 (352 bp deletion)

Chromosome

Putative gene structure

complement(join(24970..25123, 25175..25343, 25962..26031))

Map position

4.75

Balancer

Map position of balancer

Sequence of primers

ExtFwd:GAGACTAGCCAAGTACACAG,IntRev:GTCAGAGACGCAGAGGACAG,ExtRev:TCACCCGTCCATTGTAAAAG,IntFwd:ACGGGCTGGAAAATGCGGAG

Distributed lab

Depositor

Dr. S. Mitani/NBRP

References

Please submit your publication

Kolli S, Kline CJ, Rad KM, Wehman AM.
Phagolysosomes break down the membrane of a non-apoptotic corpse independent of macroautophagy.
bioRxiv 2024
[ PubMed ID = 38948720 ] [ RRC reference ]

Kolli S, Kline CJ, Rad KM, Wehman AM.
Phagolysosomes break down the membrane of a non-apoptotic corpse independent of macroautophagy.
PLoS One 2024 19(11) e0306435
[ PubMed ID = 39570954 ] [ RRC reference ]

Leboutet R, Largeau C, Müller L, Prigent M, Quinet G, Rodriguez MS, Cuif MH, Hoppe T, Culetto E, Lefebvre C, Legouis R.
LGG-1/GABARAP lipidation is not required for autophagy and development in Caenorhabditis elegans.
Elife 2023 12
[ PubMed ID = 37395461 ] [ RRC reference ]

Papandreou ME, Konstantinidis G, Tavernarakis N.
Nucleophagy delays aging and preserves germline immortality.
Nat Aging 2023 3(1) 34-46
[ PubMed ID = 37118512 ] [ RRC reference ]

Doering KRS, Cheng X, Milburn L, Ratnappan R, Ghazi A, Miller DL, Taubert S.
Nuclear hormone receptor NHR-49 acts in parallel with HIF-1 to promote hypoxia adaptation in Caenorhabditis elegans.
Elife 2022 11
[ PubMed ID = 35285794 ] [ RRC reference ]

Peña-Ramos O, Chiao L, Liu X, Yu X, Yao T, He H, Zhou Z.
Autophagosomes fuse to phagosomes and facilitate the degradation of apoptotic cells in Caenorhabditis elegans.
Elife 2022 11
[ PubMed ID = 34982028 ] [ RRC reference ]

Zaninello M, Palikaras K, Naon D, Iwata K, Herkenne S, Quintana-Cabrera R, Semenzato M, Grespi F, Ross-Cisneros FN, Carelli V, Sadun AA, Tavernarakis N, Scorrano L.
Inhibition of autophagy curtails visual loss in a model of autosomal dominant optic atrophy.
Nat Commun 2020 11(1) 4029
[ PubMed ID = 32788597 ] [ RRC reference ]

Palmisano NJ, Meléndez A.
Autophagy in C. elegans development.
Dev Biol 2019 447(1) 103-125
[ PubMed ID = 29709599 ] [ RRC reference ]

Jenzer C, Simionato E, Largeau C, Scarcelli V, Lefebvre C, Legouis R.
Autophagy mediates phosphatidylserine exposure and phagosome degradation during apoptosis through specific functions of GABARAP/LGG-1 and LC3/LGG-2.
Autophagy 2019 15(2) 228-241
[ PubMed ID = 30160610 ] [ RRC reference ]

Chen Y, Scarcelli V, Legouis R.
Approaches for Studying Autophagy in Caenorhabditis elegans.
Cells 2017 6(3)
[ PubMed ID = 28867808 ] [ RRC reference ]

Palikaras K, Mari M, Petanidou B, Pasparaki A, Filippidis G, Tavernarakis N.
Ectopic fat deposition contributes to age-associated pathology in Caenorhabditis elegans.
J Lipid Res 2017 58(1) 72-80
[ PubMed ID = 27884963 ] [ RRC reference ]

Papandreou ME, Tavernarakis N.
Monitoring Autophagic Responses in Caenorhabditis elegans.
Methods Enzymol 2016 588 429-444
[ PubMed ID = 28237114 ] [ RRC reference ]

Fazeli G, Trinkwalder M, Irmisch L, Wehman AM.
C. elegans midbodies are released, phagocytosed and undergo LC3-dependent degradation independent of macroautophagy.
J Cell Sci. 2016 129(20) 3721-3731.
[ PubMed ID = 27562069 ] [ RRC reference ]

Stavoe AK, Hill SE, Hall DH, Colón-Ramos DA.
KIF1A/UNC-104 Transports ATG-9 to Regulate Neurodevelopment and Autophagy at Synapses.
Dev Cell 2016 38(2) 171-85
[ PubMed ID = 27396362 ] [ RRC reference ]

Djeddi A, Al Rawi S, Deuve JL, Perrois C, Liu YY, Russeau M, Sachse M, Galy V.
Sperm-inherited organelle clearance in C. elegans relies on LC3-dependent autophagosome targeting to the pericentrosomal area.
Development 2015 142(9) 1705-16
[ PubMed ID = 25922527 ] [ RRC reference ]

Jenzer C, Manil-Ségalen M, Lefebvre C, Largeau C, Glatigny A, Legouis R.
Human GABARAP can restore autophagosome biogenesis in a C. elegans lgg-1 mutant.
Autophagy 2014 10(10) 1868-72
[ PubMed ID = 25126728 ] [ RRC reference ]

Manil-Ségalen M, Lefebvre C, Jenzer C, Trichet M, Boulogne C, Satiat-Jeunemaitre B, Legouis R.
The C. elegans LC3 acts downstream of GABARAP to degrade autophagosomes by interacting with the HOPS subunit VPS39.
Dev Cell 2014 28(1) 43-55
[ PubMed ID = 24374177 ] [ RRC reference ]