| Allele Name | tm5750 |
| Balance | Not Required |
| OutCross | Not Accepted |
| Sequence Name | C10C5.1 |
| Gene Name | C10C5.1 |
| Worm Base | Allele Name |
tm5750
|
| Gene Name |
C10C5.1
|
| Sequence |
C10C5.1
|
Phenotype
Information from the receiver is posted in the form
of a "researcher : phenotype"
| homozygous viable. |
Mutation site
Please see gene structure to locate the deletion in
relation to exon(s)
| 5888/5889-6141/6142 (253 bp deletion) + 6442/6443-CGTGAAACCATCG-6501/6502 (59 bp deletion + 13 bp insertion) |
| Chromosome | IV |
| Putative gene structure | complement(join(233..428, 573..664, 1390..1494, 2584..2757, 3764..3919, 4232..4363, 4411..4539, 4663..4760, 4814..4970, 5512..5666, 5708..5804, 5863..5961, 6039..6272, 6321..6549, 6599..6846, 6891..6964, 7012..7110, 7180..7246)) |
| Map position | 4.18 |
| Balancer | |
| Map position of balancer | |
| Sequence of primers | IntRev:GCACTGCTTGCAGGTTAGCT,ExtRev:AATGACGGTCCCGCCGCTTT,IntFwd:AAGGGGATTGAGATGGACGA,ExtFwd:CGCCCGTAGTTAAAGGGGAT |
| Distributed lab | |
| Depositor | Dr. S. Mitani |
| References |
Please submit your publication
Park YJ, Yeon J, Cho J, Kim DY, Bai X, Oh Y, Kim J, Nam H, Hwang H, Heo W, Kim J, Jun S, Lee K, Kang K, Kim K. PIEZO acts in an intestinal valve to regulate swallowing in C. elegans. Nat Commun 2024 15(1) 10072
[ PubMed ID = 39567502 ]
[ RRC reference ]
|
|