分離済み変異体

tm574

Allele Name

tm574

Balance

Not Required

OutCross

Not Accepted

Sequence Name

T07G12.10

Gene Name

zim-2

Worm Base

Allele Name

tm574

Gene Name

zim-2

Sequence

T07G12.10

Phenotype

homozygous viable, Dr. A. Dernburg: Dev. Cell 11, 817 (2006). Dr. W. Hanna-Rose: Genetics 177, 1221 (2007).

Mutation site

27386/27387-27801/27802 (415 bp deletion)

Chromosome

Putative gene structure

join(27217..27315, 27378..28168, 28467..28746, 28819..29079, 29171..29364, 29416..29468, 29516..29592)

Map position

4.62

Balancer

Map position of balancer

Sequence of primers

ExtFwd:CGCCGTTTCATTTGGAACTT,ExtRev:TGTCGAGTTGTCTGGCATGA,IntFwd:GCTGCTGCCCATTTTCGATA,IntRev:GACAACGCGGCAAAACAACT

Distributed lab

Depositor

Dr. S. Mitani

References

Please submit your publication

Hamrick A, Cope HD, Forbis D, Rog O.
Kinetic analysis of strand invasion during C. elegans meiosis reveals similar rates of sister- and homolog-directed repair.
bioRxiv 2025
[ PubMed ID = 39829846 ] [ RRC reference ]

Gros O, Passmore JB, Borst NO, Kutra D, Nijenhuis W, Fuqua T, Kapitein LC, Crocker JM, Kreshuk A, Köhler S.
Spherical harmonics texture extraction for versatile analysis of biological objects.
PLoS Comput Biol 2025 21(1) e1012349
[ PubMed ID = 39879256 ] [ RRC reference ]

Cao W, Fan Q, Amparado G, Begic D, Godini R, Gopal S, Pocock R.
A nucleic acid binding protein map of germline regulation in Caenorhabditis elegans.
Nat Commun 2024 15(1) 6884
[ PubMed ID = 39128930 ] [ RRC reference ]

Murari E, Meadows D, Cuda N, Mangone M.
A comprehensive analysis of 3'UTRs in Caenorhabditis elegans.
Nucleic Acids Res 2024 52(13) 7523-7538
[ PubMed ID = 38917330 ] [ RRC reference ]

Weng Y, Murphy CT.
Male-specific behavioral and transcriptomic changes in aging C. elegans neurons.
iScience 2024 27(6) 109910
[ PubMed ID = 38783998 ] [ RRC reference ]

Li Q, Hariri S, Calidas A, Kaur A, Huey E, Engebrecht J.
The chromatin-associated 53BP1 ortholog, HSR-9, regulates recombinational repair and X chromosome segregation in the Caenorhabditis elegans germ line.
bioRxiv 2024
[ PubMed ID = 38659880 ] [ RRC reference ]

Saito TT, Yamamoto K, Minami H, Tsujiue T.
Caenorhabditis elegans brc-1 mutation increases the number of COSA-1 foci in him-8 and zim-2 mutants.
MicroPubl Biol 2024 2024
[ PubMed ID = 39132054 ] [ RRC reference ]

Liu Y, Zhao Q, Nie H, Zhang F, Fu T, Zhang Z, Qi F, Wang R, Zhou J, Gao J.
SYP-5 regulates meiotic thermotolerance in Caenorhabditis elegans.
J Mol Cell Biol 2021 13(9) 662-675
[ PubMed ID = 34081106 ] [ RRC reference ]

Fabig G, Kiewisz R, Lindow N, Powers JA, Cota V, Quintanilla LJ, Brugués J, Prohaska S, Chu DS, Müller-Reichert T.
Male meiotic spindle features that efficiently segregate paired and lagging chromosomes.
Elife 2020 9
[ PubMed ID = 32149606 ] [ RRC reference ]

Janisiw E, Dello Stritto MR, Jantsch V, Silva N.
BRCA1-BARD1 associate with the synaptonemal complex and pro-crossover factors and influence RAD-51 dynamics during Caenorhabditis elegans meiosis.
PLoS Genet 2018 14(11) e1007653
[ PubMed ID = 30383754 ] [ RRC reference ]

Turcotte CA, Sloat SA, Rigothi JA, Rosenkranse E, Northrup AL, Andrews NP, Checchi PM.
Maintenance of Genome Integrity by Mi2 Homologs CHD-3 and LET-418 in Caenorhabditis elegans.
Genetics 2018 208(3) 991-1007
[ PubMed ID = 29339410 ] [ RRC reference ]

Sato-Carlton A, Nakamura-Tabuchi C, Chartrand SK, Uchino T, Carlton PM.
Phosphorylation of the synaptonemal complex protein SYP-1 promotes meiotic chromosome segregation.
J Cell Biol 2018 217(2) 555-570
[ PubMed ID = 29222184 ] [ RRC reference ]

Muscat CC, Torre-Santiago KM, Tran MV, Powers JA, Wignall SM.
Kinetochore-independent chromosome segregation driven by lateral microtubule bundles.
Elife 2015 4 e06462
[ PubMed ID = 26026148 ] [ RRC reference ]

Leopold LE, Heestand BN, Seong S, Shtessel L, Ahmed S.
Lack of pairing during meiosis triggers multigenerational transgene silencing in Caenorhabditis elegans.
Proc Natl Acad Sci U S A 2015 112(20) E2667-76
[ PubMed ID = 25941370 ] [ RRC reference ]

Stamper EL, Rodenbusch SE, Rosu S, Ahringer J, Villeneuve AM, Dernburg AF.
Identification of DSB-1, a protein required for initiation of meiotic recombination in Caenorhabditis elegans, illuminates a crossover assurance checkpoint.
PLoS Genet 2013 9(8) e1003679
[ PubMed ID = 23990794 ] [ RRC reference ]

Checchi PM, Engebrecht J.
Caenorhabditis elegans histone methyltransferase MET-2 shields the male X chromosome from checkpoint machinery and mediates meiotic sex chromosome inactivation.
PLoS Genet 2011 7(9) e1002267
[ PubMed ID = 21909284 ] [ RRC reference ]

Jaramillo-Lambert A, Harigaya Y, Vitt J, Villeneuve A, Engebrecht J.
Meiotic errors activate checkpoints that improve gamete quality without triggering apoptosis in male germ cells.
Curr Biol 2010 20(23) 2078-89
[ PubMed ID = 20970339 ] [ RRC reference ]

Jaramillo-Lambert A, Engebrecht J.
A single unpaired and transcriptionally silenced X chromosome locally precludes checkpoint signaling in the Caenorhabditis elegans germ line.
Genetics 2010 184(3) 613-28
[ PubMed ID = 20008570 ] [ RRC reference ]

Gu SG, Fire A.
Partitioning the C. elegans genome by nucleosome modification, occupancy, and positioning.
Chromosoma 2010 119(1) 73-87
[ PubMed ID = 19705140 ] [ RRC reference ]

Bessler JB, Andersen EC, Villeneuve AM.
Differential localization and independent acquisition of the H3K9me2 and H3K9me3 chromatin modifications in the Caenorhabditis elegans adult germ line.
PLoS Genet 2010 6(1) e1000830
[ PubMed ID = 20107519 ] [ RRC reference ]