| Allele Name | tm5670 |
| Balance | Completed |
| OutCross | Not Accepted |
| Sequence Name | F25B3.6 |
| Gene Name | F25B3.6 |
| Worm Base | Allele Name |
tm5670
(x1) |
| Gene Name |
F25B3.6
|
| Sequence |
F25B3.6
|
Phenotype
Information from the receiver is posted in the form
of a "researcher : phenotype"
| lethal or sterile |
|
Mutation site
Please see gene structure to locate the deletion in
relation to exon(s)
| [K09G1] 207/208-[K09G1] 623/624 (416 bp deletion) |
| Chromosome | V |
| Putative gene structure | complement(join(Z70752.1:29650..29740, Z70752.1:29786..29978, Z70752.1:30029..30182, 105..517, 573..1041, 1086..1452, 1507..1661)) |
| Map position | 2.05 |
| Balancer | nT1 [qIs51] |
| Map position of balancer | |
| Sequence of primers | IntRev:ACCTATTGTTCGTAGCCATC,ExtRev:ACTTTATTGCACCCGTCCTT,IntFwd:CGTGTAAAAGGATCATCCTG,ExtFwd:TACCTCCCTTCTTACGTGTA |
| Distributed lab | |
| Depositor | Dr. S. Mitani/NBRP |
| References |
Please submit your publication
Mazzetto M, Gonzalez LE, Sanchez N, Reinke V.
Characterization of the distribution and dynamics of chromatin states in the C. elegans germline reveals substantial H3K4me3 remodeling during oogenesis.
Genome Res 2024 34(1) 57-69
[ PubMed ID = 38164610 ]
[ RRC reference ]
|
Kubota Y, Tsuyama K, Takabayashi Y, Haruta N, Maruyama R, Iida N, Sugimoto A.
The PAF1 complex is involved in embryonic epidermal morphogenesis in Caenorhabditis elegans.
Dev Biol 2014 391(1) 43-53
[ PubMed ID = 24721716 ]
[ RRC reference ]
|
|
Copyright © 2009 NBRP-C. elegans. All rights reserved.