分離済み変異体

tm5615

Allele Nametm5615
BalanceCompleted
OutCrossNot Accepted
Sequence NameD2085.4
Gene NameD2085.4
Worm BaseAllele Name tm5615 (x1)
Gene Name D2085.4
Sequence D2085.4
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" lethal or sterile
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 24950/24951-25367/25368 (417 bp deletion)
ChromosomeII
Putative gene structurejoin(24448..24648, 24709..24926, 24980..25166, 25217..25350, 25397..25737, 25788..25887, 25934..26222, 26276..26457, 26513..26835, 27019..27284, 27335..27538, 27609..27707, 28064..28311, 28360..28432, 28479..28619)
Map position0.84
BalancermIn1 [e128 mIs14]
Map position of balancer
Sequence of primersExtFwd:CCGGGTCTTGTTATGACTGA,IntFwd:ACGGTGATGTTCGGAGGGAC,ExtRev:GGGCGATGAAAGCGTAAAGA,IntRev:CTTACGCCTCCACAAAGGTG
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Spike CA, Tsukamoto T, Greenstein D.
Ubiquitin ligases and a processive proteasome facilitate protein clearance during the oocyte-to-embryo transition in Caenorhabditis elegans.
Genetics 2022 221(1)  
[ PubMed ID = 35377419 ] [ RRC reference ]

Wang R, Kaul Z, Ambardekar C, Yamamoto TG, Kavdia K, Kodali K, High AA, Kitagawa R.
HECT-E3 ligase ETC-1 regulates securin and cyclin B1 cytoplasmic abundance to promote timely anaphase during meiosis in C. elegans.
Development 2013 140(10) 2149-59 
[ PubMed ID = 23578927 ] [ RRC reference ]