分離済み変異体

tm5597

Allele Nametm5597
BalanceNot Required
OutCrossNot Accepted
Sequence NameF35B3.5
Gene Nameptrn-1
Worm BaseAllele Name tm5597
Gene Name ptrn-1
Sequence F35B3.5
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 19328/19329-19921/19922 (593 bp deletion)
ChromosomeX
Putative gene structurecomplement(join(13705..13846, 13896..13972, 14020..14115, 14421..14530, 14883..15279, 15327..15457, 15508..15586, 15694..15882, 15954..16169, 16567..16773, 16898..17121, 17683..17909, 18068..18189, 18572..18852, 18909..19057, 19110..19170, 19358..19578, 19871..19956, 20470..20583, 20635..20736, 20996..21097, 21583..21636))
Map position24.07
Balancer
Map position of balancer
Sequence of primersIntRev:AGTCTGCACACCTTGCAATA,ExtFwd:AGTTCGAGAACGTGTAGTGC,IntFwd:CGTGTAGTGCAGAATTCTCG,ExtRev:GGAAGGATATACACAAGTACCG
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Lee H, Kang J, Lee SH, Lee D, Chung CH, Lee J.
Neuroprotective role of Hippo signaling by microtubule stability control in Caenorhabditis elegans.
Elife 2025 13  
[ PubMed ID = 40178516 ] [ RRC reference ]

Liang X, Agulto R, Eichel K, Taylor CA, Paat VA, Deng H, Ori-McKenney K, Shen K.
CRMP/UNC-33 maintains neuronal microtubule arrays by promoting individual microtubule rescue.
Curr Biol 2025 35(4) 734-745.e8 
[ PubMed ID = 39842439 ] [ RRC reference ]

Park S, Noblett N, Pitts L, Colavita A, Wehman AM, Jin Y, Chisholm AD.
Dopey-dependent regulation of extracellular vesicles maintains neuronal morphology.
Curr Biol 2024 34(21) 4920-4933.e11 
[ PubMed ID = 39378880 ] [ RRC reference ]

Park S, Noblett N, Pitts L, Colavita A, Wehman AM, Jin Y, Chisholm AD.
Dopey-dependent regulation of extracellular vesicles maintains neuronal morphology.
bioRxiv 2024   
[ PubMed ID = 38766017 ] [ RRC reference ]

Puri D, Sharma S, Samaddar S, Ravivarma S, Banerjee S, Ghosh-Roy A.
Muscleblind-1 interacts with tubulin mRNAs to regulate the microtubule cytoskeleton in C. elegans mechanosensory neurons.
PLoS Genet 2023 19(8) e1010885 
[ PubMed ID = 37603562 ] [ RRC reference ]

He L, van Beem L, Snel B, Hoogenraad CC, Harterink M.
PTRN-1 (CAMSAP) and NOCA-2 (NINEIN) are required for microtubule polarity in Caenorhabditis elegans dendrites.
PLoS Biol 2022 20(11) e3001855 
[ PubMed ID = 36395330 ] [ RRC reference ]

Xu A, Zhang Z, Ko SH, Fisher AL, Liu Z, Chen L.
Microtubule regulators act in the nervous system to modulate fat metabolism and longevity through DAF-16 in C. elegans.
Aging Cell 2019 18(2) e12884 
[ PubMed ID = 30638295 ] [ RRC reference ]

Borgen MA, Giles AC, Wang D, Grill B.
Synapse maintenance is impacted by ATAT-2 tubulin acetyltransferase activity and the RPM-1 signaling hub.
Elife 2019 8  
[ PubMed ID = 30652969 ] [ RRC reference ]

Gong T, Yan Y, Zhang J, Liu S, Liu H, Gao J, Zhou X, Chen J, Shi A.
PTRN-1/CAMSAP promotes CYK-1/formin-dependent actin polymerization during endocytic recycling.
EMBO J 2018 37(9)  
[ PubMed ID = 29567645 ] [ RRC reference ]

Borgen MA, Wang D, Grill B.
RPM-1 regulates axon termination by affecting growth cone collapse and microtubule stability.
Development 2017 144(24) 4658-4672 
[ PubMed ID = 29084805 ] [ RRC reference ]

Chuang M, Hsiao TI, Tong A, Xu S, Chisholm AD.
DAPK interacts with Patronin and the microtubule cytoskeleton in epidermal development and wound repair.
Elife 2016 5  
[ PubMed ID = 27661253 ] [ RRC reference ]

Chuang M, Goncharov A, Wang S, Oegema K, Jin Y, Chisholm AD.
The microtubule minus-end-binding protein patronin/PTRN-1 is required for axon regeneration in C. elegans.
Cell Rep 2014 9(3) 874-83 
[ PubMed ID = 25437544 ] [ RRC reference ]

Marcette JD, Chen JJ, Nonet ML.
The Caenorhabditis elegans microtubule minus-end binding homolog PTRN-1 stabilizes synapses and neurites.
Elife 2014 3 e01637 
[ PubMed ID = 24569480 ] [ RRC reference ]

Richardson CE, Spilker KA, Cueva JG, Perrino J, Goodman MB, Shen K.
PTRN-1, a microtubule minus end-binding CAMSAP homolog, promotes microtubule function in Caenorhabditis elegans neurons.
Elife 2014 3 e01498 
[ PubMed ID = 24569477 ] [ RRC reference ]