分離済み変異体

tm5597

Allele Name

tm5597

Balance

Not Required

OutCross

Not Accepted

Sequence Name

F35B3.5

Gene Name

ptrn-1

Worm Base

Allele Name

tm5597

Gene Name

ptrn-1

Sequence

F35B3.5

Phenotype

homozygous viable.

Mutation site

19328/19329-19921/19922 (593 bp deletion)

Chromosome

Putative gene structure

complement(join(13705..13846, 13896..13972, 14020..14115, 14421..14530, 14883..15279, 15327..15457, 15508..15586, 15694..15882, 15954..16169, 16567..16773, 16898..17121, 17683..17909, 18068..18189, 18572..18852, 18909..19057, 19110..19170, 19358..19578, 19871..19956, 20470..20583, 20635..20736, 20996..21097, 21583..21636))

Map position

24.07

Balancer

Map position of balancer

Sequence of primers

IntRev:AGTCTGCACACCTTGCAATA,ExtFwd:AGTTCGAGAACGTGTAGTGC,IntFwd:CGTGTAGTGCAGAATTCTCG,ExtRev:GGAAGGATATACACAAGTACCG

Distributed lab

Depositor

Dr. S. Mitani/NBRP

References

Please submit your publication

Liang X, Agulto R, Eichel K, Taylor CA, Paat VA, Deng H, Ori-McKenney K, Shen K.
CRMP/UNC-33 maintains neuronal microtubule arrays by promoting individual microtubule rescue.
Curr Biol 2025 35(4) 734-745.e8
[ PubMed ID = 39842439 ] [ RRC reference ]

Park S, Noblett N, Pitts L, Colavita A, Wehman AM, Jin Y, Chisholm AD.
Dopey-dependent regulation of extracellular vesicles maintains neuronal morphology.
Curr Biol 2024 34(21) 4920-4933.e11
[ PubMed ID = 39378880 ] [ RRC reference ]

Park S, Noblett N, Pitts L, Colavita A, Wehman AM, Jin Y, Chisholm AD.
Dopey-dependent regulation of extracellular vesicles maintains neuronal morphology.
bioRxiv 2024
[ PubMed ID = 38766017 ] [ RRC reference ]

Puri D, Sharma S, Samaddar S, Ravivarma S, Banerjee S, Ghosh-Roy A.
Muscleblind-1 interacts with tubulin mRNAs to regulate the microtubule cytoskeleton in C. elegans mechanosensory neurons.
PLoS Genet 2023 19(8) e1010885
[ PubMed ID = 37603562 ] [ RRC reference ]

He L, van Beem L, Snel B, Hoogenraad CC, Harterink M.
PTRN-1 (CAMSAP) and NOCA-2 (NINEIN) are required for microtubule polarity in Caenorhabditis elegans dendrites.
PLoS Biol 2022 20(11) e3001855
[ PubMed ID = 36395330 ] [ RRC reference ]

Xu A, Zhang Z, Ko SH, Fisher AL, Liu Z, Chen L.
Microtubule regulators act in the nervous system to modulate fat metabolism and longevity through DAF-16 in C. elegans.
Aging Cell 2019 18(2) e12884
[ PubMed ID = 30638295 ] [ RRC reference ]

Borgen MA, Giles AC, Wang D, Grill B.
Synapse maintenance is impacted by ATAT-2 tubulin acetyltransferase activity and the RPM-1 signaling hub.
Elife 2019 8
[ PubMed ID = 30652969 ] [ RRC reference ]

Gong T, Yan Y, Zhang J, Liu S, Liu H, Gao J, Zhou X, Chen J, Shi A.
PTRN-1/CAMSAP promotes CYK-1/formin-dependent actin polymerization during endocytic recycling.
EMBO J 2018 37(9)
[ PubMed ID = 29567645 ] [ RRC reference ]

Borgen MA, Wang D, Grill B.
RPM-1 regulates axon termination by affecting growth cone collapse and microtubule stability.
Development 2017 144(24) 4658-4672
[ PubMed ID = 29084805 ] [ RRC reference ]

Chuang M, Hsiao TI, Tong A, Xu S, Chisholm AD.
DAPK interacts with Patronin and the microtubule cytoskeleton in epidermal development and wound repair.
Elife 2016 5
[ PubMed ID = 27661253 ] [ RRC reference ]

Chuang M, Goncharov A, Wang S, Oegema K, Jin Y, Chisholm AD.
The microtubule minus-end-binding protein patronin/PTRN-1 is required for axon regeneration in C. elegans.
Cell Rep 2014 9(3) 874-83
[ PubMed ID = 25437544 ] [ RRC reference ]

Marcette JD, Chen JJ, Nonet ML.
The Caenorhabditis elegans microtubule minus-end binding homolog PTRN-1 stabilizes synapses and neurites.
Elife 2014 3 e01637
[ PubMed ID = 24569480 ] [ RRC reference ]

Richardson CE, Spilker KA, Cueva JG, Perrino J, Goodman MB, Shen K.
PTRN-1, a microtubule minus end-binding CAMSAP homolog, promotes microtubule function in Caenorhabditis elegans neurons.
Elife 2014 3 e01498
[ PubMed ID = 24569477 ] [ RRC reference ]