分離済み変異体

tm5512

Allele Nametm5512
BalanceNot Required
OutCrossNot Accepted
Sequence NameF49E10.5
Gene Namectbp-1
Worm BaseAllele Name tm5512
Gene Name ctbp-1
Sequence F49E10.5
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 3350/3351-3982/3983 (632 bp deletion)
ChromosomeX
Putative gene structurejoin(3476..3634, 3888..3959, 4013..4121, 5274..5351, 10082..10159, 10219..10370, 11237..11381, 11428..11552, 11599..11789, 11844..12094, 12145..12242, 12685..12811, 12867..13465)
Map position-4.16
Balancer
Map position of balancer
Sequence of primersIntRev:CTGACGGCGACTCTGGTCTA,ExtRev:AATACTAACCTGACGGCGAC,IntFwd:CTGGCACCATTGCATAACGT,ExtFwd:TAAGCATCTCGATTCTCGCA
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Saul J, Hirose T, Horvitz HR.
The transcriptional corepressor CTBP-1 acts with the SOX family transcription factor EGL-13 to maintain AIA interneuron cell identity in Caenorhabditis elegans.
Elife 2022 11  
[ PubMed ID = 35119366 ] [ RRC reference ]

Reid A, Sherry TJ, Yücel D, Llamosas E, Nicholas HR.
The C-terminal binding protein (CTBP-1) regulates dorsal SMD axonal morphology in Caenorhabditis elegans.
Neuroscience 2015 311 216-30 
[ PubMed ID = 26480814 ] [ RRC reference ]

Yücel D, Hoe M, Llamosas E, Kant S, Jamieson C, Young PA, Crossley M, Nicholas HR.
SUMV-1 antagonizes the activity of synthetic multivulva genes in Caenorhabditis elegans.
Dev Biol 2014 392(2) 266-82 
[ PubMed ID = 24882710 ] [ RRC reference ]