分離済み変異体

tm548

Allele Nametm548
BalanceNot Required
OutCrossNot Accepted
Sequence NameF25D7.3
Gene Nameblmp-1
Worm BaseAllele Name tm548
Gene Name blmp-1
Sequence F25D7.3
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable. Dr. K. Ashrafi: healthy, fertile, has a small body size and altered fat content at adult stage. Dr. R. Plasterk: Dpy appearance. Dr. R.H. Horvitz: not synMuv with class A or B mutations and not a synMuv suppressor. Dr. M. Hengartner: very slight increase in germ cell apoptosis. Dr. W. Vermeulen: Gro, Dpy, Pvl. Dr. Y-C. Wu: slightly Unc, mild Dpy, abnormal gonad morphology. Dr. O. Blacque: Dyf (+), wild-type localization of ODR-10 to AWB cilium. Dr. C. Yang: no obvious cell death defects. Dr. J. Kaplan: Sma, abnormal gonad.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 19893/19894-20703/20704 (810 bp deletion)
ChromosomeI
Putative gene structurejoin(18588..18765,19099..19193,19455..20322,20833..21179, 21562..21656, 21707..22175, 22591..22638, 22722..23075)
Map position4.99
Balancer
Map position of balancer
Sequence of primersIntRev:CAGTTATTGCGGCTGTTGTT,ExtRev:CGGATCTTCCACCAGTGGCA,IntFwd:GCGTCAGGTAAGTTGTGATA,ExtFwd:CGTCACCTGCCGGAGTTTCA
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Murari E, Meadows D, Cuda N, Mangone M.
A comprehensive analysis of 3'UTRs in Caenorhabditis elegans.
Nucleic Acids Res 2024 52(13) 7523-7538 
[ PubMed ID = 38917330 ] [ RRC reference ]

Teuscher AC, Statzer C, Goyala A, Domenig SA, Schoen I, Hess M, Hofer AM, Fossati A, Vogel V, Goksel O, Aebersold R, Ewald CY.
Longevity interventions modulate mechanotransduction and extracellular matrix homeostasis in C. elegans.
Nat Commun 2024 15(1) 276 
[ PubMed ID = 38177158 ] [ RRC reference ]

Verbeeren J, Teixeira J, Garcia SMDA.
The Muscleblind-like protein MBL-1 regulates microRNA expression in Caenorhabditis elegans through an evolutionarily conserved autoregulatory mechanism.
PLoS Genet 2023 19(12) e1011109 
[ PubMed ID = 38134228 ] [ RRC reference ]

Madhu B, Lakdawala MF, Gumienny TL.
Small-Scale Extraction of Caenorhabditis elegans Genomic DNA.
J Vis Exp 2022 (184)  
[ PubMed ID = 35758710 ] [ RRC reference ]

Huang N, Seow WQ, Appert A, Dong Y, Stempor P, Ahringer J.
Accessible Region Conformation Capture (ARC-C) gives high-resolution insights into genome architecture and regulation.
Genome Res 2022 32(2) 357-366 
[ PubMed ID = 34933938 ] [ RRC reference ]

Jiang HS, Ghose P, Han HF, Wu YZ, Tsai YY, Lin HC, Tseng WC, Wu JC, Shaham S, Wu YC.
BLMP-1 promotes developmental cell death in C. elegans by timely repression of ced-9 transcription.
Development 2021 148(20)  
[ PubMed ID = 34541605 ] [ RRC reference ]

Stec N, Doerfel K, Hills-Muckey K, Ettorre VM, Ercan S, Keil W, Hammell CM.
An Epigenetic Priming Mechanism Mediated by Nutrient Sensing Regulates Transcriptional Output during C. elegans Development.
Curr Biol 2021 31(4) 809-826.e6 
[ PubMed ID = 33357451 ] [ RRC reference ]

Padmanabha D, Padilla PA, You YJ, Baker KD.
A HIF-independent mediator of transcriptional responses to oxygen deprivation in Caenorhabditis elegans.
Genetics 2015 199(3) 739-48 
[ PubMed ID = 25552276 ] [ RRC reference ]

Huang TF, Cho CY, Cheng YT, Huang JW, Wu YZ, Yeh AY, Nishiwaki K, Chang SC, Wu YC.
BLMP-1/Blimp-1 regulates the spatiotemporal cell migration pattern in C. elegans.
PLoS Genet 2014 10(6) e1004428 
[ PubMed ID = 24968003 ] [ RRC reference ]

Horn M, Geisen C, Cermak L, Becker B, Nakamura S, Klein C, Pagano M, Antebi A.
DRE-1/FBXO11-dependent degradation of BLMP-1/BLIMP-1 governs C. elegans developmental timing and maturation.
Dev Cell 2014 28(6) 697-710 
[ PubMed ID = 24613396 ] [ RRC reference ]

Nelson MD, Zhou E, Kiontke K, Fradin H, Maldonado G, Martin D, Shah K, Fitch DH.
A bow-tie genetic architecture for morphogenesis suggested by a genome-wide RNAi screen in Caenorhabditis elegans.
PLoS Genet 2011 7(3) e1002010 
[ PubMed ID = 21408209 ] [ RRC reference ]