Allele Name | tm545 |
Allele Type | 通常株 |
Sequence Name | Y66H1B.3 |
Gene Name | fln-1 |
Worm Base | Allele Name |
tm545
|
Gene Name |
fln-1
|
Sequence |
Y66H1B.3
|
Phenotype
Information from the receiver is posted in the form of a "researcher : phenotype"
| homozygous viable. Dr. D. Greenstein: low brood size at 20C. |
Mutation site
Please see gene structure to locate the deletion in relation to exon(s)
| 26266/26267-TCAGTAAAATTTGAATA-26529/26530 (263 bp deletion + 17 bp insertion) |
Chromosome | IV |
Putative gene structure | complement(join(21251..21978, 22294..22393, 22461..23015, 23696..24231, 24532..24808, 24850..25412, 25459..25632, 26482..26653, 26702..26815, 26865..26900)) |
Map position | -26.37 |
Balancer | |
Map position of balancer | |
Sequence of primers | ExtRev:GTTTTCAGTGTATGGGAGCT,IntFwd:GCCACAGTTGGTGTATAGGA,ExtFwd:CCCAACTTTGTAAACTCCAG,IntRev:GGAGTTCCCCTTTCCTCTAT |
Distributed lab | |
Depositor | Dr. S. Mitani |
References |
Please submit your publication
Kelley CA, Triplett O, Mallick S, Burkewitz K, Mair WB, Cram EJ. FLN-1/filamin is required to anchor the actomyosin cytoskeleton and for global organization of sub-cellular organelles in a contractile tissue. Cytoskeleton (Hoboken) 2020 77(10) 379-398
[ PubMed ID = 32969593 ]
[ RRC reference ]
|
Choi S, Ambros V. The C. elegans heterochronic gene lin-28 coordinates the timing of hypodermal and somatic gonadal programs for hermaphrodite reproductive system morphogenesis. Development 2019 146(5)
[ PubMed ID = 30745431 ]
[ RRC reference ]
|
Kovacevic I, Cram EJ. FLN-1/filamin is required for maintenance of actin and exit of fertilized oocytes from the spermatheca in C. elegans. Dev Biol 2010 347(2) 247-57
[ PubMed ID = 20707996 ]
[ RRC reference ]
|
Kovacevic I, Orozco JM, Cram EJ. Filamin and phospholipase C-ε are required for calcium signaling in the Caenorhabditis elegans spermatheca. PLoS Genet 2013 9(5) e1003510
[ PubMed ID = 23671426 ]
[ RRC reference ]
|
Nakamura F, Kumeta K, Hida T, Isono T, Nakayama Y, Kuramata-Matsuoka E, Yamashita N, Uchida Y, Ogura K, Gengyo-Ando K, Mitani S, Ogino T, Goshima Y. Amino- and carboxyl-terminal domains of Filamin-A interact with CRMP1 to mediate Sema3A signalling. Nat Commun 2014 5 5325
[ PubMed ID = 25358863 ]
[ RRC reference ]
|
|