分離済み変異体

tm544

Allele Nametm544
Allele Type通常株
Sequence NameC06A1.1
Gene Namecdc-48.1
Worm BaseAllele Name tm544
Gene Name cdc-48.1
Sequence C06A1.1
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable. Dr. T. Ogura: BBRC 345, 746-753 (2006). Genes to Cells: 12, 1063 (2007). Dr. T. Hoppe: J. Struct. Biol. 156, 41 (2006), Nat. Cell Biol. 9, 379 (2007).
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 3193/3194-3861/3862 (668 bp deletion)
ChromosomeII
Putative gene structurecomplement(join(1127..1262,1312..1506,1762..2834, 2881..3708,3987..4184))
Map position3.11
Balancer
Map position of balancer
Sequence of primersIntRev:CCAACGCATCAAAGCGAAAA,ExtRev:ACATAATGGCCTCGGTTCCA,ExtFwd:CATCGAAGAACAACACGCAA,IntFwd:CACGAGCCTTGTCGAAGACA
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Martin CG, Bent JS, Hill T, Topalidou I, Singhvi A.
Epithelial UNC-23 limits mechanical stress to maintain glia-neuron architecture in C. elegans.
Dev Cell 2024 59(13) 1668-1688.e7 
[ PubMed ID = 38670103 ] [ RRC reference ]

Eck RJ, Stair JG, Kraemer BC, Liachko NF.
Simple models to understand complex disease: 10 years of progress from Caenorhabditis elegans models of amyotrophic lateral sclerosis and frontotemporal lobar degeneration.
Front Neurosci 2023 17 1300705 
[ PubMed ID = 38239833 ] [ RRC reference ]

Kumar AV, Mills J, Parker WM, Leitão JA, Rodriguez DI, Daigle SE, Ng C, Patel R, Aguilera JL, Johnson JR, Wong SQ, Lapierre LR.
Lipid droplets modulate proteostasis, SQST-1/SQSTM1 dynamics, and lifespan in C. elegans.
iScience 2023 26(10) 107960 
[ PubMed ID = 37810233 ] [ RRC reference ]

Doyle JJ, Parker JA.
Genetic Interactions of Progranulin Across the ALS-FTD Spectrum and Beyond.
MicroPubl Biol 2023 2023  
[ PubMed ID = 38188422 ] [ RRC reference ]

Tsioras K, Smith KC, Edassery SL, Garjani M, Li Y, Williams C, McKenna ED, Guo W, Wilen AP, Hark TJ, Marklund SL, Ostrow LW, Gilthorpe JD, Ichida JK, Kalb RG, Savas JN, Kiskinis E.
Analysis of proteome-wide degradation dynamics in ALS SOD1 iPSC-derived patient neurons reveals disrupted VCP homeostasis.
Cell Rep 2023 42(10) 113160 
[ PubMed ID = 37776851 ] [ RRC reference ]

Segref A, Vakkayil KL, Padvitski T, Li Q, Kroef V, Lormann J, Körner L, Finger F, Hoppe T.
Thermosensation in Caenorhabditis elegans is linked to ubiquitin-dependent protein turnover via insulin and calcineurin signalling.
Nat Commun 2022 13(1) 5874 
[ PubMed ID = 36198694 ] [ RRC reference ]

Kim S, Shin HJ, Do SH, Na HS.
Role of Unfolded Protein Response and Endoplasmic Reticulum-Associated Degradation by Repeated Exposure to Inhalation Anesthetics in Caenorhabditis elegans.
Int J Med Sci 2021 18(13) 2890-2896 
[ PubMed ID = 34220315 ] [ RRC reference ]

Franz A, Valledor P, Ubieto-Capella P, Pilger D, Galarreta A, Lafarga V, Fernández-Llorente A, de la Vega-Barranco G, den Brave F, Hoppe T, Fernandez-Capetillo O, Lecona E.
USP7 and VCPFAF1 define the SUMO/Ubiquitin landscape at the DNA replication fork.
Cell Rep 2021 37(2) 109819 
[ PubMed ID = 34644576 ] [ RRC reference ]

Cheung TP, Choe JY, Richmond JE, Kim H.
BK channel density is regulated by endoplasmic reticulum associated degradation and influenced by the SKN-1A/NRF1 transcription factor.
PLoS Genet 2020 16(6) e1008829 
[ PubMed ID = 32502151 ] [ RRC reference ]

Herzog LK, Kevei É, Marchante R, Böttcher C, Bindesbøll C, Lystad AH, Pfeiffer A, Gierisch ME, Salomons FA, Simonsen A, Hoppe T, Dantuma NP.
The Machado-Joseph disease deubiquitylase ataxin-3 interacts with LC3C/GABARAP and promotes autophagy.
Aging Cell 2020 19(1) e13051 
[ PubMed ID = 31625269 ] [ RRC reference ]

Franz A, Pirson PA, Pilger D, Halder S, Achuthankutty D, Kashkar H, Ramadan K, Hoppe T.
Chromatin-associated degradation is defined by UBXN-3/FAF1 to safeguard DNA replication fork progression.
Nat Commun 2016 7 10612 
[ PubMed ID = 26842564 ] [ RRC reference ]

Martínez-Velázquez LA, Ringstad N.
Antagonistic regulation of trafficking to Caenorhabditis elegans sensory cilia by a Retinal Degeneration 3 homolog and retromer.
Proc Natl Acad Sci U S A 2018 115(3) E438-E447 
[ PubMed ID = 29282322 ] [ RRC reference ]

Sasagawa Y, Yamanaka K, Saito-Sasagawa Y, Ogura T.
Caenorhabditis elegans UBX cofactors for CDC-48/p97 control spermatogenesis.
Genes Cells 2010 15(12) 1201-15 
[ PubMed ID = 20977550 ] [ RRC reference ]

Kuhlbrodt K, Janiesch PC, Kevei É, Segref A, Barikbin R, Hoppe T.
The Machado-Joseph disease deubiquitylase ATX-3 couples longevity and proteostasis.
Nat Cell Biol 2011 13(3) 273-81 
[ PubMed ID = 21317884 ] [ RRC reference ]

Segref A, Torres S, Hoppe T.
A screenable in vivo assay to study proteostasis networks in Caenorhabditis elegans.
Genetics 2011 187(4) 1235-40 
[ PubMed ID = 21288877 ] [ RRC reference ]

Sasagawa Y, Higashitani A, Urano T, Ogura T, Yamanaka K.
CDC-48/p97 is required for proper meiotic chromosome segregation via controlling AIR-2/Aurora B kinase localization in Caenorhabditis elegans.
J Struct Biol 2012 179(2) 104-11 
[ PubMed ID = 22735043 ] [ RRC reference ]

McMullen PD, Aprison EZ, Winter PB, Amaral LA, Morimoto RI, Ruvinsky I.
Macro-level modeling of the response of C. elegans reproduction to chronic heat stress.
PLoS Comput Biol 2012 8(1) e1002338 
[ PubMed ID = 22291584 ] [ RRC reference ]

Liu G, Rogers J, Murphy CT, Rongo C.
EGF signalling activates the ubiquitin proteasome system to modulate C. elegans lifespan.
EMBO J 2011 30(15) 2990-3003 
[ PubMed ID = 21673654 ] [ RRC reference ]

Franz A, Orth M, Pirson PA, Sonneville R, Blow JJ, Gartner A, Stemmann O, Hoppe T.
CDC-48/p97 coordinates CDT-1 degradation with GINS chromatin dissociation to ensure faithful DNA replication.
Mol Cell 2011 44(1) 85-96 
[ PubMed ID = 21981920 ] [ RRC reference ]

Zou CG, Ma YC, Dai LL, Zhang KQ.
Autophagy protects C. elegans against necrosis during Pseudomonas aeruginosa infection.
Proc Natl Acad Sci U S A 2014 111(34) 12480-5 
[ PubMed ID = 25114220 ] [ RRC reference ]