分離済み変異体

tm5426

Allele Nametm5426
BalanceCompleted
OutCrossNot Accepted
Sequence NameR01H2.6
Gene Nameubc-18
Worm BaseAllele Name tm5426 (x1)
Gene Name ubc-18
Sequence R01H2.6
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" Gro.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 32459/32460-32767/32768 (308 bp deletion)
ChromosomeIII
Putative gene structurecomplement(join(32255..32406, 32515..32701, 32760..32855, 32902..32928))
Map position-0.8
BalancerhT2
Map position of balancer
Sequence of primersIntRev:GATCCTCTTGGAAGTCATAC,ExtRev:GTTGCGGTGTTCTTGCGTAC,IntFwd:GATCTGAGCTCTTGGCGCCT,ExtFwd:CCAGACCCGGTTCAGGATTT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Kawasaki I, Sugiura K, Sasaki T, Matsuda N, Sato M, Sato K.
MARC-3, a membrane-associated ubiquitin ligase, is required for fast polyspermy block in Caenorhabditis elegans.
Nat Commun 2024 15(1) 792 
[ PubMed ID = 38278786 ] [ RRC reference ]

Poush JA, Blouin NA, Di Bona KR, Lažetić V, Fay DS.
Regulation of germ cell development by ARI1 family ubiquitin ligases in C. elegans.
Sci Rep 2018 8(1) 17737 
[ PubMed ID = 30531803 ] [ RRC reference ]

Dove KK, Kemp HA, Di Bona KR, Reiter KH, Milburn LJ, Camacho D, Fay DS, Miller DL, Klevit RE.
Two functionally distinct E2/E3 pairs coordinate sequential ubiquitination of a common substrate in Caenorhabditis elegans development.
Proc Natl Acad Sci U S A 2017 114(32) E6576-E6584 
[ PubMed ID = 28739890 ] [ RRC reference ]