分離済み変異体

tm542

Allele Nametm542
BalanceNot Required
OutCrossNot Accepted
Sequence NameY54G9A.3
Gene Namekqt-3
Worm BaseAllele Name tm542
Gene Name kqt-3
Sequence Y54G9A.3
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable. Dr. H. Baylis: increased mean defecation period which is suppressed by RNAi of gon-2 and gtl-1. BMC Physiol. 8, 11 (2008).
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 14651/14652-15652/15653 (1001 bp deletion)
ChromosomeII
Putative gene structurejoin(14551..14718, 15074..15204, 15248..15390, 15536..16325, 17316..17705, 17789..17891, 18583..18795)
Map position19.58
Balancer
Map position of balancer
Sequence of primersIntRev:GTGAGCTCACAAACGTGACT,IntFwd:CGACTGGCTGGAAGTGCTTT,ExtFwd:ATGTTCAATGCTCGATACCG,ExtRev:TACTTAACCCGTCGAATCGC
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Pieroni EM, O'Connor V, Holden-Dye L, Imperadore P, Fiorito G, Dillon J.
Identification of molecular nociceptors in Octopus vulgaris through functional characterisation in Caenorhabditis elegans.
Biol Open 2026 15(1)  
[ PubMed ID = 41431869 ] [ RRC reference ]

Delinière A, Boulin T, Jospin M, Janin A, Millat G, Chevalier P, Andrini O.
Caenorhabditis elegans as an in vivo model system for human inherited primary arrhythmia syndromes.
J Physiol 2025   
[ PubMed ID = 41342285 ] [ RRC reference ]

Kwan CS, Vázquez-Manrique RP, Ly S, Goyal K, Baylis HA.
TRPM channels are required for rhythmicity in the ultradian defecation rhythm of C. elegans.
BMC Physiol 2008 8 11 
[ PubMed ID = 18495023 ] [ RRC reference ]

Nehrke K, Denton J, Mowrey W.
Intestinal Ca2+ wave dynamics in freely moving C. elegans coordinate execution of a rhythmic motor program.
Am J Physiol Cell Physiol 2008 294(1) C333-44 
[ PubMed ID = 17942636 ] [ RRC reference ]