分離済み変異体

tm5384

Allele Nametm5384
BalanceNot Required
OutCrossNot Accepted
Sequence NameC34E10.3
Gene Namegop-1
Worm BaseAllele Name tm5384
Gene Name gop-1
Sequence C34E10.3
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 28053/28054-28567/28568 (514 bp deletion)
ChromosomeIII
Putative gene structurejoin(27655..27854, 27903..28033, 28079..28377, 28429..28621, 28669..28784, 28835..28992, 29041..29144, 29738..29943, 30043..30102, 30190..30405, 30465..30590, 30638..30760, 30808..30937, 30993..31243, 31293..31373, 31540..31824)
Map position-1.86
Balancer
Map position of balancer
Sequence of primersIntRev:CTTACTGTCTGAAGAGGAGT,ExtRev:GCTACGCATGTGTCCCTTTA,IntFwd:AAGCATTACGAGCTATCGCA,ExtFwd:TGGGTCACTATGGAAGCCGA
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Yoshida K, Suehiro Y, Dejima K, Yoshina S, Mitani S.
Distinct pathways for export of silencing RNA in Caenorhabditis elegans systemic RNAi.
iScience 2023 26(10) 108067 
[ PubMed ID = 37854694 ] [ RRC reference ]

Yin J, Huang Y, Guo P, Hu S, Yoshina S, Xuan N, Gan Q, Mitani S, Yang C, Wang X.
GOP-1 promotes apoptotic cell degradation by activating the small GTPase Rab2 in C. elegans.
J Cell Biol 2017 216(6) 1775-1794 
[ PubMed ID = 28424218 ] [ RRC reference ]