分離済み変異体

tm536

Allele Nametm536
Allele Type通常株
Sequence NameR09F10.9
Gene Nameced-13
Worm BaseAllele Name tm536
Gene Name ced-13
Sequence R09F10.9
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable. Dr. R.H. Horvitz: No extra cells in anterior pharynx. Dr. S. Shaham: Cell Death, Diff., 12, 153-161, (2005).
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 4511/4512-5034/5035 (523 bp deletion)
ChromosomeX
Putative gene structurecomplement(join(4496..4677, 4729..4843))
Map position-0.19
Balancer
Map position of balancer
Sequence of primersExtRev:CTCCATTCCCACCGCCAACT,IntFwd:GAAGGCTAGGCGGAGGAAGA,ExtFwd:GTGCGTAGCAAGAGAAATCT,IntRev:AAGGCAGTTGCTGAGACGTT
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Flowers S, Kothari R, Torres Cleuren YN, Alcorn MR, Ewe CK, Alok G, Fiallo SL, Joshi PM, Rothman JH.
Regulation of defective mitochondrial DNA accumulation and transmission in C. elegans by the programmed cell death and aging pathways.
Elife 2023 12  
[ PubMed ID = 37782016 ] [ RRC reference ]

Lee M, Youn E, Kang K, Shim YH.
3,3'-Diindolylmethane Supplementation Maintains Oocyte Quality by Reducing Oxidative Stress and CEP-1/p53-Mediated Regulation of Germ Cells in a Reproductively Aged Caenorhabditis elegans Model.
Antioxidants (Basel) 2022 11(5)  
[ PubMed ID = 35624814 ] [ RRC reference ]

Martínez-Fernández C, Bergamino M, Schiavi A, Brena D, Ventura N, Honnen S, Villanueva A, Nadal E, Cerón J.
Insights into cisplatin-induced neurotoxicity and mitochondrial dysfunction in Caenorhabditis elegans.
Dis Model Mech 2022 15(3)  
[ PubMed ID = 35107130 ] [ RRC reference ]

Min H, Kim JS, Ahn J, Shim YH.
Gliadin Intake Causes Disruption of the Intestinal Barrier and an Increase in Germ Cell Apoptosis in A Caenorhabditis Elegans Model.
Nutrients 2019 11(11)  
[ PubMed ID = 31717869 ] [ RRC reference ]

García-Rodríguez FJ, Martínez-Fernández C, Brena D, Kukhtar D, Serrat X, Nadal E, Boxem M, Honnen S, Miranda-Vizuete A, Villanueva A, Cerón J.
Genetic and cellular sensitivity of Caenorhabditis elegans to the chemotherapeutic agent cisplatin.
Dis Model Mech 2018 11(6)  
[ PubMed ID = 29752286 ] [ RRC reference ]

Ackermann L, Schell M, Pokrzywa W, Kevei É, Gartner A, Schumacher B, Hoppe T.
E4 ligase-specific ubiquitination hubs coordinate DNA double-strand-break repair and apoptosis.
Nat Struct Mol Biol 2016 23(11) 995-1002 
[ PubMed ID = 27669035 ] [ RRC reference ]

Morthorst TH, Olsen A.
Cell-nonautonomous inhibition of radiation-induced apoptosis by dynein light chain 1 in Caenorhabditis elegans.
Cell Death Dis 2013 4(9) e799 
[ PubMed ID = 24030151 ] [ RRC reference ]

Ye AL, Ragle JM, Conradt B, Bhalla N.
Differential regulation of germline apoptosis in response to meiotic checkpoint activation.
Genetics 2014 198(3) 995-1000 
[ PubMed ID = 25217053 ] [ RRC reference ]

De Henau S, Tilleman L, Vangheel M, Luyckx E, Trashin S, Pauwels M, Germani F, Vlaeminck C, Vanfleteren JR, Bert W, Pesce A, Nardini M, Bolognesi M, De Wael K, Moens L, Dewilde S, Braeckman BP.
A redox signalling globin is essential for reproduction in Caenorhabditis elegans.
Nat Commun 2015 6 8782 
[ PubMed ID = 26621324 ] [ RRC reference ]

Levi-Ferber M, Salzberg Y, Safra M, Haviv-Chesner A, Bülow HE, Henis-Korenblit S.
It's all in your mind: determining germ cell fate by neuronal IRE-1 in C. elegans.
PLoS Genet 2014 10(10) e1004747 
[ PubMed ID = 25340700 ] [ RRC reference ]

Yang M, Sun J, Sun X, Shen Q, Gao Z, Yang C.
Caenorhabditis elegans protein arginine methyltransferase PRMT-5 negatively regulates DNA damage-induced apoptosis.
PLoS Genet 2009 5(6) e1000514 
[ PubMed ID = 19521535 ] [ RRC reference ]

Maurer CW, Chiorazzi M, Shaham S.
Timing of the onset of a developmental cell death is controlled by transcriptional induction of the C. elegans ced-3 caspase-encoding gene.
Development 2007 134(7) 1357-68 
[ PubMed ID = 17329362 ] [ RRC reference ]

Schumacher B, Schertel C, Wittenburg N, Tuck S, Mitani S, Gartner A, Conradt B, Shaham S.
C. elegans ced-13 can promote apoptosis and is induced in response to DNA damage.
Cell Death Differ 2005 12(2) 153-61 
[ PubMed ID = 15605074 ] [ RRC reference ]