分離済み変異体

tm5302

Allele Nametm5302
BalanceNot Required
OutCrossNot Accepted
Sequence NameEGAP2.3
Gene Namepho-1
Worm BaseAllele Name tm5302
Gene Name pho-1
Sequence EGAP2.3
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 5768/5769-6332/6333 (564 bp deletion)
ChromosomeII
Putative gene structurecomplement(join(3859..3899, 3977..4040, 4089..4376, 4444..4616, 4956..5073, 5122..5214, 5266..5361, 5608..5787, 5835..5930, 6141..6245, 6293..6388))
Map position-2.31
Balancer
Map position of balancer
Sequence of primersIntRev:ATTGGCATCGAGTAGCCAAC,ExtRev:GACACTCATCAGTGGCATGA,IntFwd:GATACTACTGCCGAGCACAC,ExtFwd:CGGCGCCCATTTTTGACCAG
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Cornwell AB, Zhang Y, Thondamal M, Johnson DW, Thakar J, Samuelson AV.
The C. elegans Myc-family of transcription factors coordinate a dynamic adaptive response to dietary restriction.
Geroscience 2024 46(5) 4827-4854 
[ PubMed ID = 38878153 ] [ RRC reference ]

Cornwell A, Zhang Y, Thondamal M, Johnson DW, Thakar J, Samuelson AV.
The C. elegans Myc-family of transcription factors coordinate a dynamic adaptive response to dietary restriction.
bioRxiv 2023   
[ PubMed ID = 38045350 ] [ RRC reference ]

Radeke LJ, Herman MA.
Identification and characterization of differentially expressed genes in Caenorhabditis elegans in response to pathogenic and nonpathogenic Stenotrophomonas maltophilia.
BMC Microbiol 2020 20(1) 170 
[ PubMed ID = 32560629 ] [ RRC reference ]