分離済み変異体

tm5218

Allele Nametm5218
BalanceNot Required
OutCrossNot Accepted
Sequence NameT22H6.1
Gene NameT22H6.1
Worm BaseAllele Name tm5218
Gene Name T22H6.1
Sequence T22H6.1
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 3127/3128-3795/3796 (668 bp deletion)
ChromosomeX
Putative gene structurecomplement(join(3057..3191, 3237..3338, 3391..3534, 4186..4369, 4498..4553))
Map position8.39
Balancer
Map position of balancer
Sequence of primersExtFwd:AGATCTGACCACGAGGTCTT,IntFwd:ATCTCCATCCGCATTCGCAT,ExtRev:ATCACATTGAGGGTGGTAGA,IntRev:TTCCTACCGATGAGTACAGT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Godthi A, Min S, Das S, Cruz-Corchado J, Deonarine A, Misel-Wuchter K, Issuree PD, Prahlad V.
Neuronal IL-17 controls Caenorhabditis elegans developmental diapause through CEP-1/p53.
Proc Natl Acad Sci U S A 2024 121(12) e2315248121 
[ PubMed ID = 38483995 ] [ RRC reference ]

Flynn SM, Chen C, Artan M, Barratt S, Crisp A, Nelson GM, Peak-Chew SY, Begum F, Skehel M, de Bono M.
MALT-1 mediates IL-17 neural signaling to regulate C. elegans behavior, immunity and longevity.
Nat Commun 2020 11(1) 2099 
[ PubMed ID = 32350248 ] [ RRC reference ]

Chen C, Itakura E, Nelson GM, Sheng M, Laurent P, Fenk LA, Butcher RA, Hegde RS, de Bono M.
IL-17 is a neuromodulator of Caenorhabditis elegans sensory responses.
Nature 2017 542(7639) 43-48 
[ PubMed ID = 28099418 ] [ RRC reference ]