分離済み変異体

tm5159

Allele Nametm5159
BalanceNot Required
OutCrossNot Accepted
Sequence NameT01G9.3
Gene NameT01G9.3
Worm BaseAllele Name tm5159
Gene Name T01G9.3
Sequence T01G9.3
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 9239/9240-9911/9912 (672 bp deletion)
ChromosomeI
Putative gene structurejoin(9024..9227, 9304..10135, 10288..10472, 10570..10698, 10748..10855, 10903..11256)
Map position2.7
Balancer
Map position of balancer
Sequence of primersExtRev:GTGGTTGTAGGCCAGTTCGA,IntRev:ATAGGTCCATGACTCCTCGA,ExtFwd:CTCATGGTGTTTTGCCTCAC,IntFwd:ACTACCATCATCATGTCCGA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Iosilevskii Y, Hall DH, Katz M, Podbilewicz B.
The PVD neuron has male-specific structure and mating function in Caenorhabditis elegans.
Proc Natl Acad Sci U S A 2025 122(13) e2421376122 
[ PubMed ID = 40138342 ] [ RRC reference ]

Fang J, Jiang W, Zhao W, Wang J, Cao B, Wang N, Chen B, Wang C, Zou W.
Endocytosis restricts dendrite branching via removing ectopically localized branching ligands.
Nat Commun 2024 15(1) 9651 
[ PubMed ID = 39511227 ] [ RRC reference ]

Taylor CA, Maor-Nof M, Metzl-Raz E, Hidalgo A, Yee C, Gitler AD, Shen K.
Histone deacetylase inhibition expands cellular proteostasis repertoires to enhance neuronal stress resilience.
bioRxiv 2024   
[ PubMed ID = 39229034 ] [ RRC reference ]

Land R, Fetter R, Liang X, Tzeng CP, Taylor CA, Shen K.
Endoplasmic Reticulum Exit Sites scale with somato-dendritic size in neurons.
Mol Biol Cell 2023 34(11) ar106 
[ PubMed ID = 37556208 ] [ RRC reference ]

Ji H, Fouad AD, Li Z, Ruba A, Fang-Yen C.
A proprioceptive feedback circuit drives Caenorhabditis elegans locomotor adaptation through dopamine signaling.
Proc Natl Acad Sci U S A 2023 120(20) e2219341120 
[ PubMed ID = 37155851 ] [ RRC reference ]

Eichel K, Uenaka T, Belapurkar V, Lu R, Cheng S, Pak JS, Taylor CA, Südhof TC, Malenka R, Wernig M, Özkan E, Perrais D, Shen K.
Endocytosis in the axon initial segment maintains neuronal polarity.
Nature 2022 609(7925) 128-135 
[ PubMed ID = 35978188 ] [ RRC reference ]

Rahman M, Ramirez-Suarez NJ, Diaz-Balzac CA, Bülow HE.
Specific N-glycans regulate an extracellular adhesion complex during somatosensory dendrite patterning.
EMBO Rep 2022 23(7) e54163 
[ PubMed ID = 35586945 ] [ RRC reference ]

Androwski RJ, Asad N, Wood JG, Hofer A, Locke S, Smith CM, Rose B, Schroeder NE.
Mutually exclusive dendritic arbors in C. elegans neurons share a common architecture and convergent molecular cues.
PLoS Genet 2020 16(9) e1009029 
[ PubMed ID = 32997655 ] [ RRC reference ]

Tao L, Porto D, Li Z, Fechner S, Lee SA, Goodman MB, Xu XZS, Lu H, Shen K.
Parallel Processing of Two Mechanosensory Modalities by a Single Neuron in C. elegans.
Dev Cell 2019 51(5) 617-631.e3 
[ PubMed ID = 31735664 ] [ RRC reference ]

Richardson CE, Yee C, Shen K.
A hormone receptor pathway cell-autonomously delays neuron morphological aging by suppressing endocytosis.
PLoS Biol 2019 17(10) e3000452 
[ PubMed ID = 31589601 ] [ RRC reference ]

Tang LT, Diaz-Balzac CA, Rahman M, Ramirez-Suarez NJ, Salzberg Y, Lázaro-Peña MI, Bülow HE.
TIAM-1/GEF can shape somatosensory dendrites independently of its GEF activity by regulating F-actin localization.
Elife 2019 8  
[ PubMed ID = 30694177 ] [ RRC reference ]

Salzberg Y, Coleman AJ, Celestrin K, Cohen-Berkman M, Biederer T, Henis-Korenblit S, Bülow HE.
Reduced Insulin/Insulin-Like Growth Factor Receptor Signaling Mitigates Defective Dendrite Morphogenesis in Mutants of the ER Stress Sensor IRE-1.
PLoS Genet 2017 13(1) e1006579 
[ PubMed ID = 28114319 ] [ RRC reference ]

Díaz-Balzac CA, Rahman M, Lázaro-Peña MI, Martin Hernandez LA, Salzberg Y, Aguirre-Chen C, Kaprielian Z, Bülow HE.
Muscle- and Skin-Derived Cues Jointly Orchestrate Patterning of Somatosensory Dendrites.
Curr Biol 2016 26(17) 2379-87 
[ PubMed ID = 27451901 ] [ RRC reference ]

Zou W, Yadav S, DeVault L, Nung Jan Y, Sherwood DR.
RAB-10-Dependent Membrane Transport Is Required for Dendrite Arborization.
PLoS Genet 2015 11(9) e1005484 
[ PubMed ID = 26394140 ] [ RRC reference ]

Salzberg Y, Ramirez-Suarez NJ, Bülow HE.
The proprotein convertase KPC-1/furin controls branching and self-avoidance of sensory dendrites in Caenorhabditis elegans.
PLoS Genet 2014 10(9) e1004657 
[ PubMed ID = 25232734 ] [ RRC reference ]

Salzberg Y, Díaz-Balzac CA, Ramirez-Suarez NJ, Attreed M, Tecle E, Desbois M, Kaprielian Z, Bülow HE.
Skin-derived cues control arborization of sensory dendrites in Caenorhabditis elegans.
Cell 2013 155(2) 308-20 
[ PubMed ID = 24120132 ] [ RRC reference ]