| Allele Name | tm5089 |
| Balance | Not Required |
| OutCross | Not Accepted |
| Sequence Name | F59A3.9 |
| Gene Name | pup-3 |
| Worm Base | Allele Name |
tm5089
|
| Gene Name |
pup-3
|
| Sequence |
F59A3.9
|
Phenotype
Information from the receiver is posted in the form
of a "researcher : phenotype"
| homozygous viable. |
|
Mutation site
Please see gene structure to locate the deletion in
relation to exon(s)
| 32252/32253-TA-32540/32541 (288 bp deletion + 2 bp insertion) |
| Chromosome | I |
| Putative gene structure | complement(join(30080..30617, 31205..31397, 31450..31578, 31733..31841, 32212..32396, 32444..32543, 32835..33029)) |
| Map position | 0.1 |
| Balancer | |
| Map position of balancer | |
| Sequence of primers | IntRev:CAACCTTGTCATTGCTCTAC,ExtRev:GAATAGAGCGTCTTACGTAC,IntFwd:TCTACACTTTTGTGCGGGAG,ExtFwd:CGGTTAGAACTGGGTTGGTT |
| Distributed lab | |
| Depositor | Dr. S. Mitani/NBRP |
| References |
Please submit your publication
Pastore B, Hertz HL, Tang W.
The ribonuclease DISL-2 mediates piRNA degradation in C. elegans.
Cell Rep 2025 44(10) 116430
[ PubMed ID = 41075248 ]
[ RRC reference ]
|
Kelley LH, Caldas IV, Sullenberger MT, Yongblah KE, Niazi AM, Iyer A, Li Y, Tran PM, Valen E, Ahmed-Braimah YH, Maine EM.
Poly(U) polymerase activity in Caenorhabditis elegans regulates abundance and tailing of sRNA and mRNA.
Genetics 2024 228(2)
[ PubMed ID = 39067069 ]
[ RRC reference ]
|
Wang Y, Weng C, Chen X, Zhou X, Huang X, Yan Y, Zhu C.
CDE-1 suppresses the production of risiRNA by coupling polyuridylation and degradation of rRNA.
BMC Biol 2020 18(1) 115
[ PubMed ID = 32887607 ]
[ RRC reference ]
|
Li Y, Maine EM.
The balance of poly(U) polymerase activity ensures germline identity, survival and development in Caenorhabditis elegans.
Development 2018 145(19)
[ PubMed ID = 30305273 ]
[ RRC reference ]
|
|
Copyright © 2009 NBRP-C. elegans. All rights reserved.